header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11087
Transcript Name: alox5ap-201
Previous Names: alox5ap-001, zgc:63982-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028608 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028608|OTTDARG00000022261|ZDB-GENE-030131-9322 alox5ap|OTTDARP00000023392 CH211-135J7.2-001 LG_ BX548163.15 Danio rerio protein_coding KNOWN, 1304 bp
CCATCAGGCTGCAGTTACACACCAACAGCTCTAAAACTAA
CCTAAACCTTTACACTCGACAACATGTACGCCTCAGTGAT
GGACAACATTTTCTTACTGGTGCTGGTCACTCTACTCAGC
GTTGTTCAGAATGTGTTTTTTGCCCTAAAGGTTGAGAAAG
AGTGCACAGGTCATCAATCGAAACGTTCTGCAGCTTTCGA
GCGCTTGTCCTGTGCAAAGCGAAACTGCATGGATACGTAC
CCTACATTTCTGGCAGTGCTGTGGTGCGCTGGTATCTGCC
TCAGTCAAGCTCCAGCTGCCTTTGCTGGTATTCTCTACCT
TGTTGTCCGCCAGAAGTATTTTGTTGGCTACTTGGGGGAG
ACTTGCCAAAGTACCCCTGGCTTCCTGTTTGGGAAACGGA
TTCTATTCTTCCTGTCACTCATGTGTGTTGTGGGAATTAT
AAATCACCTGATGCTCACGTATGGTGGCAGCGACTATAAA
GAATACATCCAGACCATCACTAAAGCAGCGTCCACCCTTC
TGCTCCTGCCCTAATCTGGGCCAACATCTCAGTGTAGAGG
AGGATCTCTTTCAGTTAAAGCTTTATCAGTTTGAGGATAT
AACAAAAAAGGTAGAAGAAAAAAAGACAGTGTGAAGCGTT
TACATGATTAAAAATAACATTTAATTGCAAAAATGGTTTG
TACATATTACAAATTAACACAGGAAGACATAAAACAGCTG
TTAAATCCCAGCGTAATGTATTTAAATATGTTTTAAAGGG
CTCATATCAATCAGTGAAGTTTCAGTTGTGGCCAAAATAG
TAAGGATTTAGAGTTTAAGCCTGTTTCTGTGTATAAACAA
ACAAGCAAGACACAAGTTCTCTGTATTTAAATGAATACTG
TTGTGTTAACCGCTCTTAAAATAGTCTGTTTGTAATATCG
TGCCATTAAAAAAAGTTCCAAGTTCTGCATATGCACCGGA
TTGCCGGTTTCCTGTTGTGTAGAAATTTAGCGCATATATC
AACAGCCTCTTTGCACAGTCTGGATTACATAACAGGATTG
CAAAATATTCAGTGAAGAAATGTCAAGATCAGACTGAAAC
CTTGTTAAAAATACACGTTTTTAATGACACTCTGGAAGTG
CGGAGTAGATGATGCTACACACAGCACAGGTCAGAGGAAA
ATGTGATGTTTTAATCTGTGACGTGAGAAAGGTTTTCACT
TTGCTGTAAAATATAAAGAAAAATTTGATTTCCTTATGAC
ATGAGACATTTAAAGCAAGGAAAGGAACACATTCAGACAC
ATACAGTGACCAATTTTTAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
alox5ap-201 Contained in:
OTHER alox5ap-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028608 (1)
  • Ensembl_Trans:ENSDART00000077008 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC053181 (1) 1327bp
    GenBank:CK238166 (1) 820bp
    GenBank:BG737558 (1) 528bp
    CITATIONS (2)