header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11053
Transcript Name: opcml-201
Previous Names: opcml-001, zgc:92901-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028567 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028567|OTTDARG00000022236|ZDB-GENE-040927-3 opcml|OTTDARP00000023356 CH211-160M18.1-001 LG_none BX957285.10,CR925809.24 Danio rerio protein_coding KNOWN, 2044 bp
TTTCCTCACCTATCCGAGCGCGAGAGCACCACCGACCGCG
TTCTCTCTGTTTCCAGGAGTATTACTGCCTCTTTCCCCGC
ACGCAACCGGCTCGTTACTGCACTGAACATCCTCTGGCAG
AATTTGTGCGGGTCTTATTAAAGAGTATTGAAAACGACGA
GGCTCAGAACGAGGCTGAAGCATCTTTAAGAGCGCGCGCA
TCTCTCTGAGCGCGCGAGCAACATATGTGCTGCCTCTGAA
GACGCGCTACAGCACCACAGTGTGTCTGATAAACGACCGA
ATATACGTTTCAAAACGAAAACTTTCAAGGAATATTCTCG
AGCATTTGAAGCGGATTTCCTCTCAGCCACACCGAGTAAA
ACTAATAGTTTTGGAGATATTTTAAAGACGGAATACGAAG
TGAACGCTGCGTTCCGAGGGGAATCACATACACGCTCCTT
CAGTAAAACGGTTGATCTTTGCGGACGGAAGTTTCTGAGT
TTCCTCACGGAACAAAATGGGCATAACTGGTTATTTTGAG
CTGCAGTGGAAATGCCTGGTTGTTGTGGCTCTAAGACTGC
TGTTCCTTGTGCCCGCAGGAGTGCCAGCGAGAAGCGGAGA
CTCTTATTTAAAGGACAACATCACTGTCAGACAGGGAGAC
AGTGCTGTCTTGAAGTGCAGTGTGGACAACAAAGTATCAC
GGGTGGCATGGCTCAACCGGACCACCATCCTCTTCACGGG
CAATGAGAAATGGTCATTGGACCCCCGGGTGGTTCTGCTA
AACACAGCAGTCAATGAATACAGTATAAAGATCCTAAATG
TGAACTTGTACGACGAGGGCCCGTATGTGTGTTCCATCCT
CACGAACAAGAAACCAGAGTCGACCAAAGTGCACCTCATC
GTACAAGTTCCTGCCAGGATTGTAAACGTTTCCACCGATG
TTTCAGTGAACGAGGGCAGTAACGTAAGCCTCATGTGTCT
GGCCATCGGAAGACCCGAACCCTCCATTTTGTGGAAATTT
CGTTCTTCAAAAGGGAACCGTATCGTGACGGAGGGCGAAT
ATGTGGAAATGACAGGAATCACTAAAGACATGTCAGGCTC
ATATGACTGCATCACTTCCAATGACATCTCACCTCCAGAT
GTCAGGACTGTCCAGGTCACTGTAAACTATCCGCCTGTCA
TTTCGAGAGCTCGCAGCACAGGAACGGCCGTCGGACAGAA
AGGAGTGCTGTGGTGCGAGGCGTCTGCCGTTCCTCTTGCT
GATTTTCAGTGGTTTAAAGGGGAGCGCAGAATCCTCAACG
GATTCAACGGGGTCAAGATCGAAAACAAGGGGAAACAGTC
CATGCTAACGTTCTTCAACGTCTCTGAGGAGGATTACGGC
AACTACACCTGCGTGGCCATCAACACACTGGGAATAACAA
ATGCCAGCATCATTCTCTACGGCCCCGGAGCGATACACGA
TGTGAACAACGCAGCCTTATCGCCAACCTGCTCGCTCTTG
CTTCTAACTCTGCTTTTAACCCTGTCGCTCCTCAGCAAGT
TTTGATGCTAAAGCAGCGTTTCCGCTCGTCCGAAAAACAC
ACACACAAGACTCACAGTCCCACACACCGAGAACAGGGGA
AAGTACTTGATCAGCTATTATTATTACCGCTTATCATTTT
GCCTTATGTTTTATTTCTGAAGGCACGTGTCAGTGTGGGT
TTCTGGGTCTGTAATGAGATGCTTTGGGGTTTAACCGTGT
TTTGAAACAGTGAACTGGACTGTGAATGGAGTGGAGTTTG
TTAGCTGGGTAGAAATAATAATAATAATAATAATAATAAT
AGAACCACTATATGTGTCTCTCCAACCTTTTGTATGTGAA
AAGAGAAGCAAAAATTCATGTAATCGTGAATAACTGGATG
GTTTTTTTGCTCAGTATTGAACAGTGTGAATTGAGGTTAC
TGGTGTGTCCTGTTTTCCTGTAAGATAACATGTTTCTTTT
TTTCTTTCTTTTTTTAAAGAATAAATGAAAATGACAAACA
GCAAAAAAGAAACAAACAAAAAACCTTTGAAGAAAAAAAA
AAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
opcml-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000028567 (1),  Ensembl_Trans:ENSDART00000020054 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC081685 (1) 2055 bp
GenBank:EE207193 (1) 360 bp
GenBank:EE205436 (1) 356 bp
CITATIONS (2)