ZFIN ID: ZDB-TSCRIPT-090929-10999
Transcript Name: dgat2-202
Previous Name: dgat2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028511 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028511|OTTDARG00000022198|ZDB-GENE-050913-15 dgat2|OTTDARP00000023307 CH211-147G3.2-001 LG_ CR293504.11 Danio rerio protein_coding KNOWN, 1593 bp
GCGGCCGACGCCAGTACAGAGAGAGAGATGCTGTAGAGCA
GCTCAACCTTCAGCTCACATTTCTTTACTTTACCTTAATT
TATTCCTCTAGCCTCAACCATGAAGACCATACTTGCTGCA
TATTCCGGTGTCAAAAAGGGCTCGGGCTCCAGCATCCTCT
CTGCCTTACACGACCTGCCCACCGTCCCGTGGCTGACCCG
ATCCAAAATGGTGAAGCATCTGCAGGTGATCTCCGTGCTG
CAGTTTATCATGACATTTCTTACCATGGGCATTGCTTGCT
CTTTGCTGCTGATGTACATGTTTTGCACAGACTTCTGGGT
CATTTCTGTGCTTTACGTTGCCTGGCTTATCTATGACTGG
AACACCCCTGGACAAGACATCTTTATCTCAGGAGGCCGCA
GATCGACCTGGGTGAGAGACTGGACTGTGTGGAAATACAT
GAGAGACTATTTTCCCATAAGACTCATCAAGACGCATAAC
CTGCTTCCCAGCCGAAACTACATTTTTGGCTACCACCCTC
ATGGCATCTTGTGTTTTGGGGCTTTTTGTAACTTCGGGAC
AGAAGCCACAGGATTCACCAAGGTGTTCCCAGGAATCAAG
CCATCTCTGGCCACATTGGCTGGAAACTTTCGCTTGCCCA
TGTTCAGGGAATACCTGATGTGCGGAGGAATCTGCCCAGT
AAACCGAAACTCTATCGACTACCTCCTGTCCAGTAACGGC
ACAGGCAACGCTGTGGTCATCGTGATCGGAGGAGCTGCAG
AATCCCTGGACTGTGCACCAGGAAGAAACTCTGTCATGCT
GAAAAAACGCAAAGGCTTTGTGAAACTGGCTCTAAAGCAA
GGTGCGGATCTGGTGCCAGTTTACTCCTTTGGGGAGAATG
AGGTTTACAAACAGCTGATTTTTGAAGAAGGGTCTTGGTG
GCGTACTATTCAGAGGAAACTTCAGAAGTTTTTAGGCTTT
GCCCCTTGTTTGTTTCATGGCTGTGGACTGTTTTTCCCAG
AGTCCTGGGGTCTGGTGCCTTACTGCAAACCTATCACTAC
AGTTGTTGGTGAACCTATCACTGTGCCAAAGATAGAGGAG
CCGACTCAGGACGTCATAGACATGTACCACGCCATGTACA
TCAGGTCCCTAAAGTCTCTCTTTGACAATTACAAGACCCG
CTTCGGTCTGAATGAGAGCGATACCCTTATCATTCACTGA
GGAATGATGATAACTGTCCAAACGAACACTCTGGAATATC
ATTCAGCCAACGTAAATGCCCATTCAGAGAAGGTGCTGTT
TCTCTTCATTCAATACTGTATATCTACTGAAATCCGCTGC
AGTGATTTCAGCTTACGATACTTCTGCTACTTCTGCTGAT
TTTTGCACAGACTGATGCCAAATATTCACCTTTTTCTTAC
GCCCCATGATGCTTTGCATGAATTATGGGAGGATCTTCTG
CTAAACTGTAAATAATCAGCTATTTTTAAGTATTTTCTTT
TATTTAAACCGTTTACAATGAGGTGTCCTCACATTACACC
CATTAAATAGTAACCTTATTAAACCACTTTCAGCAGACCA
CAAATGACCCCAAAAACTCAACAGTAAAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dgat2-202 Contained in:
[BAC] CH211-147G3 (1)

Genome Resources: Vega_Trans:OTTDART00000028511 (1),  Ensembl_Trans:ENSDART00000137608 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC096927 (1) 1600 nt
GenBank:CK710196 (1) 684 nt
CITATIONS (2)