header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10990
Transcript Name: btg3-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028501 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028501|OTTDARG00000022192|ZDB-GENE-031113-19 btg3|no_translation CH211-222E20.2-002 LG_ CR392341.14 Danio rerio protein_coding KNOWN, 942 bp
ATATGAATTCAAGGCCTGGGAAGTACTTAAAAACAAACAT
TGGCTTGAAAGTGCTTGAATTTATAGTTTTATTGAGTTTA
TGATGTTATTTCTTTAACAACTGTAATGAACTGAGAATTC
ATCATTTTAAAATTTACACATTTAAAGAACTTTGACAAAT
AATGCATTTTAGCAATATTTTAGAAACTGCATTTAAATAA
TACCAGTATTGAATTCAACTAATTGCATTGAAGTTTTTTT
TAACATGACTGCTTAAAACTGTCAACATTTTGAAAATGAC
ACATTCAAAACATCATCATTGACATTTTAATTTAAATATT
AAGTGTAAATAAAATGTTAAGTACAAGAAGGACTTTCATG
GCACTGTATATGCTGGGGTGTTCATTACAAAGGTGCATGG
TTTAAAACTATTAGTGACTTTAAAAGTCCTGGAATTTGGT
GTCCATGAAAGAGTAAGAACTCTGTGATGTGTTGGTTTGT
TTTTGACCCATCTTTTCTTCTGGCTACAGGTATGGCGAGA
AGAATCATGGTTTCACTGTGGCCACTTTCTCAAGCGAGGA
CGATGATGATAAAGAGGATGTGACAAAGAAAGTGACGAGC
GCCGTGGAGCGGGTCACGTCGGATTACCACTCTGGATCCT
CCTCAGATGAAGACATCAGCTGTAGGGAGATCCAGTATAC
GACACCTCTTCACAACCAGCCTCCTTACCAGGTTGTTTAT
GCCAGTGCCCCAGGATGGCATCCGGTACCAAGAAAGAAAT
TTGGCCCGGGGAAAGGGCACTACCCTCAGCGGCCGCACTA
CATGATCCGCCCCCCCTGTAGACCCAACCATTCCTTTAAA
GCACACAGCTGGGTCCAGCAGGGCTACCGCAGCAAACCCG
GCTACTGGGCCAGCAATTCAAACCTACTACACCAGCTTCA
GTGACCACTCTTACTACAGCAT

btg3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA btg3-002 942
mRNA btg3-202 (1) 1013
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
btg3-002 Contained in:

OTHER btg3-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028501 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AI964419 (1) 934bp
    CITATIONS (1)