header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10989
Transcript Name: btg3-202
Previous Name: btg3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028500 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028500|OTTDARG00000022192|ZDB-GENE-031113-19 btg3|OTTDARP00000023299 CH211-222E20.2-001 LG_ CR392341.14 Danio rerio protein_coding KNOWN, 1013 bp
CTCCGAGCATGCGCACAAGACACAGTCACGTCACACACAT
AGTCGCGCGGGGGAGCTGGATTGGAAGTGGCTTGTGCGCG
AGGCAGAAGGAGTTTTCCACATGTGGATGAAAAGAAAACA
CGAAGTTGGACCTGAATTTCAGCTCAACAGCTAACAATGA
AGAAAGAAATTGCAGCGGTGGTGTTTTTCCTGAAGCGGTT
GATAAAGAAAGCTGAGAAGTTAGATGCGGACAAGGTGGAC
CTGTTTGTGGAGCGGTTAACAGTAGCATTACAGGAGAAGT
ATAAAGGTCACTGGTATCCGGACAACCCCAGCAAAGGCCA
GGCATTCAGGTGCATCAGAGTCAACCGCTTCCAGAAAGAA
GATGCTGAGTTGCTGAGAGCTTGCGCTGAAAGTGGAGTGC
AGTACAAAGACCTTGGCCTGCCTAAAGAGCTCACACTTTG
GGTTGATCCTGGTGAGGTGTGCTGTAGGTATGGCGAGAAG
AATCATGGTTTCACTGTGGCCACTTTCTCAAGCGAGGACG
ATGATGATAAAGAGGATGTGACAAAGAAAGTGACGAGCGC
CGTGGAGCGGGTCACGTCGGATTACCACTCTGGATCCTCC
TCAGATGAAGACATCAGCATGTTAGTTCATCGGTGTTAGT
GTGAGGGGTGTTACGTTGAAAAGTGTTTTTTTGAAGTTAC
CACTAAGACGACTGACCAAATTTTTTAAGAAACGTATTTT
TGTAGTTCTACTGTCACTGTTTTTTGAATTTGTGACTCGT
CTGTTTTTTAAAGGAACGATAACTGTAACTGTTTGCACTT
TAGAGTATTTGTAATAGAGCGTGTATTCGTACATATTGGA
TTAGGAGTATTTAGAGTATTTCAATTTTTATGGTAATGGA
AAATTGTGCTGTATTTGTTATATGGGATCATTTGATAACA
CTTTACATCATGTTTTATTTATTCACAGTAAACTATTATG
TATTGCATAGACCACTTAAATTATGAATAACATTAAAAAG
ACGTTTTCATGAA

btg3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA btg3-002 (1) 942
mRNA btg3-202 1013
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
btg3-202 Contained in:
OTHER btg3-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028500 (1)
  • Ensembl_Trans:ENSDART00000131220 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC085526 (1) 972bp
    GenBank:CV118024 (1) 898bp
    GenBank:CO916032 (1) 884bp
    GenBank:CO813091 (1) 846bp
    GenBank:CV118593 (1) 827bp
    GenBank:CN177144 (1) 734bp
    GenBank:BI865611 (1) 578bp
    CITATIONS (2)