ZFIN ID: ZDB-TSCRIPT-090929-10938
Transcript Name: acbd7-202
Previous Name: acbd7-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028446 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028446|OTTDARG00000022156|ZDB-GENE-050913-108 acbd7|OTTDARP00000023252 acbd7-002 LG_ BX322614.3 Danio rerio protein_coding KNOWN, 403 bp
ATCAGTGCATCTACGCTACGCTCAAGCCGACATCACAGCC
GCTCAACACTCGCCTAAGAAAATGACTTTAAAGGCAGAAT
TCGATCAATATGCAGAGGATGTGAAGAAAGTCAAGACCAG
ACCTACAGACCAGGAGCTGCTGGATTTGTACGGCCTCTAC
AAACAAGCTGTTGTTGGGGATATTAATATTGATAAACCTG
GGATGATCGATTTGAAAGGGAAAGCCAAATGGGATGCATG
GGATTCAAGGAAAGGTAATGAATAAACACTGTTAAAAATA
TTTATTATTATATAATATCTGTTATAATAGCAGATGTATA
ACCATTTATTTGAACAGAAATTGTCCCTAACCTGATTATG
TGGGTTATGTGGGTTATGTGTTTTCTGCTTTTACACACTT
CTG

acbd7 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA acbd7-201 (1)    Ensembl 907
acbd7-202 403
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acbd7-202 Contained in:
[BAC] CH211-215G1 (1)

Genome Resources: Vega_Trans:OTTDART00000028446 (1),  Ensembl_Trans:ENSDART00000141708 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK691072 (1) 408 nt
CITATIONS (2)