Transcript

acbd7-202

ID
ZDB-TSCRIPT-090929-10938
Name
acbd7-202
Previous Names
  • acbd7-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028446 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028446|OTTDARG00000022156|ZDB-GENE-050913-108 acbd7|OTTDARP00000023252 acbd7-002 LG_ BX322614.3 Danio rerio protein_coding KNOWN, 403 bp
ATCAGTGCATCTACGCTACGCTCAAGCCGACATCACAGCC
GCTCAACACTCGCCTAAGAAAATGACTTTAAAGGCAGAAT
TCGATCAATATGCAGAGGATGTGAAGAAAGTCAAGACCAG
ACCTACAGACCAGGAGCTGCTGGATTTGTACGGCCTCTAC
AAACAAGCTGTTGTTGGGGATATTAATATTGATAAACCTG
GGATGATCGATTTGAAAGGGAAAGCCAAATGGGATGCATG
GGATTCAAGGAAAGGTAATGAATAAACACTGTTAAAAATA
TTTATTATTATATAATATCTGTTATAATAGCAGATGTATA
ACCATTTATTTGAACAGAAATTGTCCCTAACCTGATTATG
TGGGTTATGTGGGTTATGTGTTTTCTGCTTTTACACACTT
CTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations