ZFIN ID: ZDB-TSCRIPT-090929-10937
Transcript Name: acbd7-201
Previous Name: acbd7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028445 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028445|OTTDARG00000022156|ZDB-GENE-050913-108 acbd7|OTTDARP00000023251 acbd7-001 LG_ BX322614.3 Danio rerio protein_coding KNOWN, 907 bp
GTAAACTCGATTCATCAGTGCATCTACGCTACGCTCAAGC
CGACATCACAGCCGCTCAACACTCGCCTAAGAAAATGACT
TTAAAGGCAGAATTCGATCAATATGCAGAGGATGTGAAGA
AAGTCAAGACCAGACCTACAGACCAGGAGCTGCTGGATTT
GTACGGCCTCTACAAACAAGCTGTTGTTGGGGATATTAAT
ATTGATAAACCTGGGATGATCGATTTGAAAGGGAAAGCCA
AATGGGATGCATGGGATTCAAGGAAAGGTATGTCAACTGA
AGATGCCATGAAAGCCTACATTACACTGGCCAAGCAAGCC
ATCGAAAAGTATGGAAAGTGATGGGGGCAAAATCAAACTA
ACATCTGCAAATTTAGATGTAAAGAGTATATAGATGTAAA
CATTCACCATGAAAACAACACGACGGGGTCACACTTTACA
ATAATGTTAATTAATGCATTTACTAACATGAACAAACAAT
GAACAATACATTTACTACTGTATTTGTTCATGCTAGTTAA
CGTTATTTAATGATAATACAGTAGTTCATTGTTAGTTAAT
GTTAACTCATGGTGCATTAACTAATGTTAACAAGCATGGA
CTTGGATGTTAATAATGCATTAATAAATGTTCAGTTATGA
TTAATATATATCATGTTCATGTGTTTTTCATGATTAGTTC
ATGTTAGTAAACGCATAATGAACCTTATTGTAAAGTGTTA
CCCACGACCGAAACTTTATATAGGCTTAATGTAATATAGA
TGAACAAATGACAAGATAATAATCTTGGTTTTGTAGTTCT
ACTTCCTGATTATATGTCAGGTGAGTCCTCAAGATGGAAG
CCTGTAATCTTGCTTTTTTTATATTTAAAAAAATGAGTCA
CTGAATAAAGCTCAAATATCACTTTAA

acbd7 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA acbd7-201 907
acbd7-202 (1)    Ensembl 403
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acbd7-201 Contained in:
[BAC] CH211-215G1 (1)

Genome Resources: Vega_Trans:OTTDART00000028445 (1),  Ensembl_Trans:ENSDART00000046209 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC097225 (1) 978 nt
GenBank:CN506072 (1) 773 nt
GenBank:AW232030 (1) 693 nt
CITATIONS (2)