Transcript

tsku-201

ID
ZDB-TSCRIPT-090929-10902
Name
tsku-201
Previous Names
  • tsku-001
  • zgc:56201-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028407 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028407|OTTDARG00000022128|ZDB-GENE-030131-4683 tsku|OTTDARP00000023221 tsku-001 LG_ BX537138.6 Danio rerio protein_coding KNOWN, 2403 bp
ATCGCTGAGTGAAACTCTAGACGAGTCTGCTTGCGGTGGC
GTTTATCGCTTCATCTTTTGCGGCGAGACTGTAGCCGATA
ACTACATCGACAAAATCACAACCCAAACAGTACCGCAAAC
GAGCTCGTTCGCCCCGCGACAAAACGCCCTGGATATGACA
GTCACCAAAGCTGAAGGCTTTTCCGATGCTGGCCTGGAAA
AGTAAGAGCTCTCCGGCGGACGAGTCGCGGCACATGCTCA
CCATGGCGTCTCTGCTGTGCCTCTTCTTCTCTTTGCTTGG
CCTGGCTGCCATTGGTGCTGTGAAGAACTGTCATCCGCAG
TGTCGGTGTGAAGTGGAGACCTTCGGCCTCTTCGACAGCT
TTAGCCTTACCAAAGTGGACTGTAGCAGAATCGGCCCTGG
AAACACCCCAGTCCCCATTCCTTTGGACACATCCCATCTG
GACCTCTCCCTCAACTCCATCACCTCCATCAGCGACACGA
TGCTTTCTGGACCGGGTTACACCACCTTAGTCAGTTTGGA
CCTAAGCAGCAATCTTATTGCGCAAATCAGTCCCAAAGCG
TTCTCCAAACTGCGTTACCTTGAGACTTTAGACTTGAGCA
GCAATGCTCTCGAAGGTCTCAGCGACGGCTGCTTCACTGG
ACTCCCTCTAGTTGAGCTAGACCTGAGTGAAAACCAATTC
AAAGAGTTCAACCTTGATCTCTTTACCACCAGGACACAGG
ATTTACCAATAATGGTGGACTTGTCACGAAACCTTCTTAC
CTCCATTTTTAGGAGAACACCAGGCCATCCGTTGTACATC
AAGAGTCTTATGCTTGCAGGGAACCAATTGAAGACGGTGC
CGAAACTTAATGGGATTCCACTTCAGTATCTGAACCTGGA
TGGAAATCTCATCTCTAGCATTGACACAGGAGCCTTTGAT
TCGCTGACAGAATTGGTTCACCTGTCTCTCAGCGGCCTGT
CCGAACTGACCTTGATTCATCCAGGTGCTTTCAGGAGTCT
GAAGAACCTGCAGGCTTTAGACTTGTCCAACAATAGCCAA
CTTAAGACGCTGAACCCTGATGTTTTTAGCGGACTCGTCT
CTTTACAAGAGCTGAATTTGTCCAATACTGCTGTCACACC
ATTATCAAGGACCGTCTTTATGCAGATGCCAAACATAAAG
AGTATAACTCTAGGGCCAAACGTGCATTGCTGGAAGACAC
ACAAGCAGGGACAGTTTCACAGGCAGATTGGACAGGCCAA
ACCCAATGATATACTTACCTGTGACAACGCAGGACTGATC
TTATGAGCCTGAAGTGCCAAGGAAAGACTTATTTTCTCAT
CTCTGTGCCTTAATAATATCTTATAAGACTTTTGTAGTTC
AAGATTGCATCGTATTTGCACATTGTTTGCCAACCGAGGT
CCACCATTTTACTTGTTCGTCACATTTCAGTATATCGCAA
TGACTCGTGCACTTTAGTTACCACATTTCTGTTCTTCTAC
TTAAAGTCAGTTGAGATCTGCAGTGTGTTGTCAGCTCTGA
TGTGATGTGTTTGATTTGGTTTGGTTCAACACAGAACTTA
GTCTTAAAGTTTCTTTAGTTGTGTGTAAATGTACACCAGT
TTTGAAGTTATGGTACCATAGATAGTATTCAGTTTACCCA
AAAATGAAAAGTTTGCCATCAATTACTCGCCTTCACTTGT
TTTGGACCTGCTTTTTTATGATTATGATGATGATGATCAT
GATGATGATAAAGAACACAAAAGAAGTTATTTTGATAAAT
GTTGGAAATGTGTAGCCTTTCACTTCTTAAGTGTTTCCTA
TTAAAGATGTCGATGGCTATCGTTTTCCAGCACTCTTCAA
AATACCTTATTTTGTGCCAACAGAAAAAAGAAATTAATGC
AGGATTGGAACTACTTAAGTAAATGGTGATGAAATTTCCA
TTTTTGGTGTAAACTATTCCTTTCAATTTACACCAACACA
TAGGTTGTATTTATTTATTTTTTATTAATTTACAGTGAAC
CACAAACATTGAGGGCGATAAGTAAAAGTGTTTTACTCGT
TTCAAGTGGAGCTTTTTAATAGAATCACTAAGTTTGAAAT
CACTATTTGGAATTTACATTTTAATGCTGAATAAAAAAAT
GTATTAATCAGTTTAGCGTTGCAAACTAAAAAATAAAATA
TTCTCTACACATCACTCAGACTGACACTTGAAGGAAATGT
AACGTTAACTAGTTCACAACCTTTTAATTCCTAAGTCGTC
ATTTCACAGACGTTTACATAATATTGCTCTGAAATTTTGC
ACTTTTGATGTTCTTATAAGATTTGTATAAATTTTTAAAA
GAAAATGCATGATGGTTGTTCATCATGTGAGATGTTTTAC
GTTTGTACAAAACTATACTCCTAATAAAAGATAATCAACT
TTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations