Transcript

agt-201

ID
ZDB-TSCRIPT-090929-109
Name
agt-201
Previous Names
  • agt-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002186 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002186|OTTDARG00000002040|ZDB-GENE-030131-1205 agt|OTTDARP00000001937 agt-001 LG_ AL772289.10 Danio rerio protein_coding KNOWN, 1676 bp
CTCAGTCCACCACAGTCCAGCTCTAGAATCAGCAAAGCAT
CTGAAGGGGTCTCGCGGATTACCCGACAAGATGAAGATGT
TCCTCGCTTTCTTATTTCTCTCCTGCTTTGCAATGGCAAG
AACCAATCGAGTGTATGTCCACCCATTCAACCTCTTCAGC
TCTGAAAACATCAGCTGTGAGGTGATCCAGAGTGAAGAGC
ACAAGCCGCTGGAGACCGTTCATCCTCTACCTCCTCTTCC
AGGCAGCACAGATCCAGACCCACGGACGGCCAGTGCAGCC
GAGAGCCTAAAGAACCTCACTCAGCGCACTGCCGTGCTTG
CAGAGCTCCAGAACTCACTGGGTTTGCGCATGTACCAGAC
GCTCAGTCGCACACAGAAACACACCAATACGCTTCTGTCA
CCGTTAAACGCATTCGGTGCATTGGTGACCCTCTATTTGG
GAGCTTCCAAAAAAACGGCCATTTCATACCAGCAGCTGTT
AGGACTCAATCTGGAGTCTGAACAGACAGATTGCGCTTAT
TTTGTTGACGGACACACAGTTTTACGCACGCTTCAGGCCA
TCAGTGCACATGTTGACGAGTCCCGAAAAGAGCTCAGGAC
CCTCGTGTGGACTTTTGTTAACAGCGATGCAGATCTTTCC
AAAGAGTTTCTGCGTGGGACTCAAGATTTCTCGGATGATT
CTTTTGTTCGATCGGTGGATTTCTCCCAGGCAAAGGATGC
AGAAGTGGAGGTCAATAACTTCATCCAGAAAACCTCTGAC
AACAAAGTGAAGAGCATGTTTAAGGGCGTAACTCCAAAGA
CTGACCTTCTGTTTGCTAGTTCAGTGCATTTCAAAGGTAA
CTGGAAAACTGCATTTCAACCTGAAGCAACCAGTGACCAG
GACTTCTGGACTCAAAAGAACTCCAGTGTTCAAGTGCCCT
TCATGATGCACACTGGAGACTACAAATACCTGGATGATGC
TGGCAGAAAGTGCTCAATAGTCAGACTGGGTCTCAGCAAG
AGGACGTTCATGTTGCTGGTGCTGCCTCATGAGGGAGCCA
GTCTACAGGACATCGAGAAGCCGCTCCTCACAGTCATTCC
TACATGGCTTCGACACCTCAAGGAAAAATATCTGGAACTA
TCTTTGCCCAAATTCTCCTTGACTGCTGTGACTGATCTGA
GATCGGTGCTATCAGAAATGGCAGTGGAGAAATACCTCAT
GGGCTCTGATGCCAGTTTTAGAAGAATGAGCAGCAAGGAG
AACTTCACTGTTGATAAGGTACTCAACAAGGTGGTGTTTG
AGATGACGGAGGGCGGATCAGAGGTTCAGAACAGAACTGA
TGATGGCAGAGCTCCTCACAAAGTCACGTTCAATCGGCCA
TTCTTCTTTGCTGTTGTAGAGGGAAACTCAAATGCCATAT
TAATGCTCGGCAAAATCATCAACCCAACAGCCTAAAAACA
TGATCGCAGTTTTGATGATGACTTTATAAGAAAATATATG
CCTACATTTATCTATCTGTATAGTAAATCAATGGACAGCA
TTAAGACCAGGTCAACCGGTGATATGTTTGTTTAGACAAG
CTTAATTAAACTAGTCTTTATTCAGATGTTTTATGTATCT
GCTAATTTCAAACTACTGTAAATAAAAGTAACTGTACAAA
GTAAAATATGTAATAAAACTGACTAAATAACCCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations