header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10885
Transcript Name: heatr3-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028389 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028389|OTTDARG00000022116|ZDB-GENE-040426-1876 heatr3|no_translation DKEY-14I19.1-002 LG_ BX663605.6 Danio rerio protein_coding KNOWN, 483 bp
CACAGATTCTCTTGGTGGCGCTTCAAGTCTGCAGGCTGTG
GCTCAGCACCTCTCCTCACTGGTCTTCAGCTCGGCAGAGG
TTTTAAAGGATGAGGAGTTCCTGGAGGCTGTGACCAGTGC
TCTCCGATCTCTGCTACAGATCATGGCTACCAAAAACATC
TCTCAGTGTGAAGGTTAACGCTCTGGCCATTCTTGGAATC
ACAGGAAGCTCACTTGCCAAAGACAAAAACACAGCAGACA
CTCTGCAGGTAAATACTGATTGTTAGAATTTTACTGAAAG
CTGCTTTACTACTCTGACAAACACACACACACACACAAAA
TGCTTTGCCTGTTTTGAAACTCTTTTTGAAACTGCATTGT
CAAAAAATATGATGTAATTATTAGTTGATCTATTAAGTTG
ATATGTTGATATTGGGGAAAATGCACTTACTTGTATGGTA
TACTTAAAGGGATAGTTAACCCAAAAACAAAACACTTCCT
CAC

heatr3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA heatr3-002 483
mRNA heatr3-201 (1) 2372
heatr3-203 (1) 467
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
heatr3-002 Contained in:
[BAC] DKEY-14I19 (1) (order this)

OTHER heatr3-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028389 (1)
  • Ensembl_Trans:ENSDART00000147698 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB962391 (1) 483 bp
    CITATIONS (2)