header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10884
Transcript Name: heatr3-201
Previous Name: heatr3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028388 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028388|OTTDARG00000022116|ZDB-GENE-040426-1876 heatr3|OTTDARP00000023207 DKEY-14I19.1-001 LG_ BX663605.6 Danio rerio protein_coding KNOWN, 2369 bp
GTGGCGCTGTCGACTGTCAACGACAGTTTTCGCGCGACAG
TTTATTTCACTTTACGGCAGCGACGTACGTCCACATGGTC
GCTCGTGTTGTGAGTCTACGCGAGTTTAAAATACAAGATA
ATTGATATTACACGTCAAGTGTAGTCAAAACAGTTAACAA
TGGGAAAAACAAAGAATCCTAAATTCAAACGGTCGCAGTT
TTCTCCCGACGGTCTTGCAGCAACTGCTGTTAAAAACACT
GTTGAAGAAGCAGAAGATGAAGAAGACTCTCCGGCAGCTG
AGCTACTGGAAAAATTGCAGAGTCCCTCAGCAGATGTGCG
CGAGTATGCCTGTGCCAGTATCTCTCGGATTGTCCAGGAG
AATCAAACCTTACCAGGATTCCTCCAAAGAGATGCAGTGA
GGAAAATTGGACCTTTATTGCTTGATCACAGCCTGACGGT
CAGAGAAACTGCTACAGGAGCGCTCAGGAATCTCAGTGCC
AGTGGAGGTCCTGAAGTATGTGAGGACATGGTGAGACAGG
ATGTGCTGACGCCTCTGTCTGCTCTCCTGAGGGAGTGCTG
TGCAGGCTTTGGCGTGAACTCTCCTTCTAAGAAAGGACAG
AAAACCTCAGTGGAAGATGTCGCCAATGAAGCAGTCAATT
TACTTTGGAACCTCTGTGAGAGCAGCAGCACAGCAGTGTC
CGTGTTTAACAAGGCTGGACTTGTGGATGTTCTTCTACAA
TGTCTACAAAAGCACCCTCAGAATATGGAGCTGGCAATAT
CAGCAGCCCACTGTTTGCACACAGTAACAGAGGAGAACTC
AGAGCTGATACGCAGTGGGAATGCAGCTGTGTTTGGGGTC
TTGGACAACATTCTGTCTTCCACACACACCAGTATGGAGA
ACATTCTCCTGCGCACACTGGCTGCAGGATCTTTATGGAA
TCTGAAAAACGGTCTGTCCTCAGCTCAGCAGTCTCACACA
CTGACCGCACTGGCCAGCACACTGTCACACAGCCTCAGTC
TGGACGCAGGAGAGCTGATCCCACAACTGTGGCGAGCTGA
ATCTGCCCGTCTGTCTAAAGACACCACATCTGTCACAGAG
ACACATCACACAGACCAGCGGCCTGCAGGGCTTCAGGTCG
AAGAGATGGAGGAGGAATTGAATGATCAGAAGAGGAATGG
AGGAAAGCCTAATGTACAAATGTCAAGAACCAAAAACGAC
ATCTCCGATCTGTTGCCTCGAGACCGACTGGAGTTGCGAG
AGGCTAAAGCACTGCTGTCAGCACAGCAAACGTCTCTGGA
GATCATCGTCAACATGTGCTGCTCTGATGAGCCCTCTGAT
GATGAATGGGAGGAGATGTCCAGCAGCGATGAGAGCGAAA
TGTGTGCTGATGGGATGTCAGACACTAATTCCAGCTTGTT
CTCTCCTCTCTGTCTGTCTGCTGAACTTCACACAGTCCTG
CTCAACCACAGCATGCCTCAACAGGTGTTGAAGAAGGCTG
AGTTCCCTAGTGCTGCTGCACTTGAGCTCTGTAGCAAAGA
TTCTTCTTGGAAATGCCTCTTGAAAAAGATGCAGCGGGTG
CAGTGTCGGGCACTGACATGTCTCCATAATATCCTCTCCT
CTATGGACACAGATTCTCTTGGTGGCGCTTCAAGTCTGCA
GGCTGTGGCTCAGCACCTCTCCTCACTGGTCTTCAGCTCG
GCAGAGGTTTTAAAGGATGAGGAGTTCCTGGAGGCTGTGA
CCAGTGCTCTCCGATCTCTGCTACAGATCATGGCTACCAA
AAACATCTCTCAGTGTATGACTCCACACCAGCTAATGGGT
TTTTGTGAGGCTGCCACCAGCTGCGATCTGGTCAGTGTGA
AGGTTAACGCTCTGGCCATTCTTGGAATCACAGGAAGCTC
ACTTGCCAAAGACAAAAACACAGCAGACACTCTGCAGCTG
ATTGGAAATGCATTACTAAATGTAGCAACAAAGGACGCAA
ACCTGGTAGTGTGTGGGGAAGCTCTTGATGCTCTCTTCGA
CGTGTTTGCCGATGGCGATGAAGCAGAGAAAGCTGCAAAA
AATATTGACCTGCTTTCTTCTCTCAAAGCCCTTCAACCAG
GGTTTAGAGCCAAGCTGCGAAAAGAAGGCAAAGGAAAATA
CAGCCCTGATCAGCTTTGCGTTCTGGACAACATAAGGATC
AACCTGAAGAGATTTATCGGCTACTTGGAGAACCTGCAAA
GAAAATGAGATTTAAGTGATCAGCAGAGCAACTCTTATTT
AGCATTTCCTGTTTATAATCCTTTTTGGTTTTATTTTTAT
GTGAGAGTGTTTATGTGAGGAAATGAAGACATAAAATAAT
GTTTGTAAAACCAAACATATGAGTGCTTTAATTAAAGCAT
TAACTATCA

heatr3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA heatr3-002 (1) 483
mRNA heatr3-201 2372
heatr3-203 (1) 467
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
heatr3-201 Contained in:

OTHER heatr3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028388 (1)
  • Ensembl_Trans:ENSDART00000052368 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC063980 (1) 2321bp
    GenBank:DT882445 (1) 789bp
    GenBank:BM317376 (1) 470bp
    CITATIONS (2)