Transcript

zgc:113274-201

ID
ZDB-TSCRIPT-090929-10803
Name
zgc:113274-201
Previous Names
  • zgc:113274-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028303 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028303|OTTDARG00000022062|ZDB-GENE-050508-2 zgc:113274|OTTDARP00000034441 CH211-249H16.4-002 LG_ CR847788.7 Danio rerio protein_coding KNOWN, 1460 bp
GAGGCGACAGATTCCGGCGGAAGGACATTACTGTCTAAAA
CAAATCCTGGACAGGAGGCTGTCAGACTATGTTGCTCCAC
TTGTGGTGACACATTAGACAGTAAAACATGCTATGGACAT
GGGGTAAGATGAACCAGTGAGGAAGTTGAGACAATCGCCT
TCCCTTGTATCAAGGCTTTGTCATGTGAGCAAACATAATG
GAAGTGCGTATCATATCCAGCTATCAGTAAATGAAAGAAA
CACAAAGGATAAGTGGCCAACTATCATGCCACGAAACTAC
ATTCGGAAAACCGACTGGGGCTCAGTGACCTACGAGGAGC
TGGAGAAAGCATTCGTTGAGGTGAAGCGTGGGAAATCGAT
CCGAACAGTGGCGAAAGAAAGAAAGATCGGCAGATCCACA
CTGCAGAGATACATGAAGAAGGCCGAAGAAAGAAGAGAGA
GAACTGTGGGCTACAGAGGAACGGCAGAAGCCAAAAGGAT
CTTCTCTGAAGAACTGGAGGAAGAGCTTGCAGAAAACATC
CGCATAATGTCTGAACGCGTCCGTGGCCTCGCAACAAAGA
AATGCAGAGAAATCGCTTTTGAATTTGCACAAAAACACAA
CATTCCTGTCCCTAACAATTGGGGAGAGCAGAGGTTAGCA
GGTCGAGACTGGCTGAGTAGCTTCATAAACCGCCACAATC
TCTACGGCCATCTTACTGAAGCAGCGTCTTTGGAAAGTCA
TGGACAGGGCATCCGTTTAAGTCTTGTCAACCATGATGAA
ATCAAGTCAGAAATCATAGAGAGTGATGTTCCTGCCCTGA
TCCATGACGCTTCAGAAGAGGAGAGCAACGGAATCTGTCA
TCCAGACCTGTTAGACGCTCACATATTTCTTACATGATGT
TATATGATGAAGCAAAAGGGGTGAGAAACTTTGTGATGCT
TAATCTGGTTTCTTGTTGGTTTATGGATGAACTAAAAACA
GCTGTAAGAACAGTTTTCAAATTTCACAATTACAAGTGAC
GGTTTCTATATCTTTATGTTTTGACAGTGTACTCTCACAT
TATTAGTGCGGTGTAAGCATTATCTAAATTTTAGGTAGAT
ATAAATATAAACTGGGCGTCACGGTGACGCAGTGGGTAGC
ACAATCGCCTCACAGCAAGAAGATCGCTGGTTCGAGCCTC
GTCTGGGTCAGTTGGCATCTCTGTGTGGAGTTTGCATGTC
CTCCCAGTGTTGGCTTGGGTTTCCCCCACAGTCCAAACAC
ATGCGCTATAGGTGCATTGAGTAAGCTAAAATTGTGTATG
TAGTGTATGTGTGTGAATAAGTGTGTATGGATGTTTCCTA
ATGATGGGTTGCAGCTGGAAAGGCATCCGCTGCCTAAAAC
ATATGCTGGATTAGTTGGCGGTTCATTCTGCTGTGGAGAC
TCCAGATTAATAAAGGGACTAAGCCGAAAAGAAATGAATA
TATGAAAGAATAAATATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations