ZFIN ID: ZDB-TSCRIPT-090929-10803
Transcript Name: zgc:113274-201
Previous Name: zgc:113274-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028303 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028303|OTTDARG00000022062|ZDB-GENE-050508-2 zgc:113274|OTTDARP00000034441 CH211-249H16.4-002 LG_ CR847788.7 Danio rerio protein_coding KNOWN, 1460 bp
GAGGCGACAGATTCCGGCGGAAGGACATTACTGTCTAAAA
CAAATCCTGGACAGGAGGCTGTCAGACTATGTTGCTCCAC
TTGTGGTGACACATTAGACAGTAAAACATGCTATGGACAT
GGGGTAAGATGAACCAGTGAGGAAGTTGAGACAATCGCCT
TCCCTTGTATCAAGGCTTTGTCATGTGAGCAAACATAATG
GAAGTGCGTATCATATCCAGCTATCAGTAAATGAAAGAAA
CACAAAGGATAAGTGGCCAACTATCATGCCACGAAACTAC
ATTCGGAAAACCGACTGGGGCTCAGTGACCTACGAGGAGC
TGGAGAAAGCATTCGTTGAGGTGAAGCGTGGGAAATCGAT
CCGAACAGTGGCGAAAGAAAGAAAGATCGGCAGATCCACA
CTGCAGAGATACATGAAGAAGGCCGAAGAAAGAAGAGAGA
GAACTGTGGGCTACAGAGGAACGGCAGAAGCCAAAAGGAT
CTTCTCTGAAGAACTGGAGGAAGAGCTTGCAGAAAACATC
CGCATAATGTCTGAACGCGTCCGTGGCCTCGCAACAAAGA
AATGCAGAGAAATCGCTTTTGAATTTGCACAAAAACACAA
CATTCCTGTCCCTAACAATTGGGGAGAGCAGAGGTTAGCA
GGTCGAGACTGGCTGAGTAGCTTCATAAACCGCCACAATC
TCTACGGCCATCTTACTGAAGCAGCGTCTTTGGAAAGTCA
TGGACAGGGCATCCGTTTAAGTCTTGTCAACCATGATGAA
ATCAAGTCAGAAATCATAGAGAGTGATGTTCCTGCCCTGA
TCCATGACGCTTCAGAAGAGGAGAGCAACGGAATCTGTCA
TCCAGACCTGTTAGACGCTCACATATTTCTTACATGATGT
TATATGATGAAGCAAAAGGGGTGAGAAACTTTGTGATGCT
TAATCTGGTTTCTTGTTGGTTTATGGATGAACTAAAAACA
GCTGTAAGAACAGTTTTCAAATTTCACAATTACAAGTGAC
GGTTTCTATATCTTTATGTTTTGACAGTGTACTCTCACAT
TATTAGTGCGGTGTAAGCATTATCTAAATTTTAGGTAGAT
ATAAATATAAACTGGGCGTCACGGTGACGCAGTGGGTAGC
ACAATCGCCTCACAGCAAGAAGATCGCTGGTTCGAGCCTC
GTCTGGGTCAGTTGGCATCTCTGTGTGGAGTTTGCATGTC
CTCCCAGTGTTGGCTTGGGTTTCCCCCACAGTCCAAACAC
ATGCGCTATAGGTGCATTGAGTAAGCTAAAATTGTGTATG
TAGTGTATGTGTGTGAATAAGTGTGTATGGATGTTTCCTA
ATGATGGGTTGCAGCTGGAAAGGCATCCGCTGCCTAAAAC
ATATGCTGGATTAGTTGGCGGTTCATTCTGCTGTGGAGAC
TCCAGATTAATAAAGGGACTAAGCCGAAAAGAAATGAATA
TATGAAAGAATAAATATAAA

zgc:113274 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript zgc:113274-201 1460
mRNA zgc:113274-202 (1)    Ensembl 671
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:113274-201 Contained in:
[BAC] CH211-249H16 (1)

Genome Resources: Vega_Trans:OTTDART00000028303 (1),  Ensembl_Trans:ENSDART00000082295 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC094296 (1) 1470 nt
CITATIONS (2)