Transcript

zgc:113274-202

ID
ZDB-TSCRIPT-090929-10802
Name
zgc:113274-202
Previous Names
  • zgc:113274-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028302 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028302|OTTDARG00000022062|ZDB-GENE-050508-2 zgc:113274|OTTDARP00000023143 CH211-249H16.4-001 LG_ CR847788.7 Danio rerio protein_coding KNOWN, 671 bp
GAGGCGACAGATTCCGGCGGAAGGACATTACTGTCTAAAA
CAAATCCTGGACAGGAGGCTGTCAGACTATGTTGCTCCAC
TTGTGGTGACACATTAGACAGTAAAACATGCTATGGACAT
GGGGTAAGATGAACCAGTGAGGAAGTTGAGACAATCGCCT
TCCCTTGTATCAAGGCTTTGTCATGTGAGCAAACATAATG
GAAGTGCGTATCATATCCAGCTATCAGTAAATGAAAGAAA
CACAAAGGATAAGTGGCCAACTATCATGCCACGAAACTAC
ATTCGGAAAACCGACTGGGGCTCAGTGACCTACGAGGAGC
TGGAGAAAGCATTCGTTGAGGTGAAGCGTGGGAAATCGAT
CCGAACAGTGGCGAAAGAAAGAAAGATCGGCAGATCCACA
CTGCAGAGATACATGAAGAAGGCCGAAGAAAGAAGAGAGA
GAACTGTGGGCTACAGAGGAACGGCAGAAGCCAAAAGGAT
CTTCTCTGAAGAACTGGAGGAAGAGCTTGCAGAAAACATC
CGCATAATGTCTGAACGCGTCCGTGGCCTCGCAACAAAGA
AATGCAGAGAAATCGCTTTTGAATTTGCACAAAAACACAA
CATTCCTGTCCCTAACAATTGGGGAGAGCAGAGGTTAGCA
GGTCGAGACTGGCTGAGTAGCTTCATAAACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations