ZFIN ID: ZDB-TSCRIPT-090929-10802
Transcript Name: zgc:113274-202
Previous Name: zgc:113274-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028302 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028302|OTTDARG00000022062|ZDB-GENE-050508-2 zgc:113274|OTTDARP00000023143 CH211-249H16.4-001 LG_ CR847788.7 Danio rerio protein_coding KNOWN, 671 bp
GAGGCGACAGATTCCGGCGGAAGGACATTACTGTCTAAAA
CAAATCCTGGACAGGAGGCTGTCAGACTATGTTGCTCCAC
TTGTGGTGACACATTAGACAGTAAAACATGCTATGGACAT
GGGGTAAGATGAACCAGTGAGGAAGTTGAGACAATCGCCT
TCCCTTGTATCAAGGCTTTGTCATGTGAGCAAACATAATG
GAAGTGCGTATCATATCCAGCTATCAGTAAATGAAAGAAA
CACAAAGGATAAGTGGCCAACTATCATGCCACGAAACTAC
ATTCGGAAAACCGACTGGGGCTCAGTGACCTACGAGGAGC
TGGAGAAAGCATTCGTTGAGGTGAAGCGTGGGAAATCGAT
CCGAACAGTGGCGAAAGAAAGAAAGATCGGCAGATCCACA
CTGCAGAGATACATGAAGAAGGCCGAAGAAAGAAGAGAGA
GAACTGTGGGCTACAGAGGAACGGCAGAAGCCAAAAGGAT
CTTCTCTGAAGAACTGGAGGAAGAGCTTGCAGAAAACATC
CGCATAATGTCTGAACGCGTCCGTGGCCTCGCAACAAAGA
AATGCAGAGAAATCGCTTTTGAATTTGCACAAAAACACAA
CATTCCTGTCCCTAACAATTGGGGAGAGCAGAGGTTAGCA
GGTCGAGACTGGCTGAGTAGCTTCATAAACC

zgc:113274 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript zgc:113274-201 (1)    Ensembl 1460
mRNA zgc:113274-202 671
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:113274-202 Contained in:
[BAC] CH211-249H16 (1)

Genome Resources: Vega_Trans:OTTDART00000028302 (1),  Ensembl_Trans:ENSDART00000132627 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK693019 (1) 677 nt
GenBank:EB792340 (1) 500 nt
GenBank:EB863702 (1) 418 nt
CITATIONS (2)