Transcript

fam43b-201

ID
ZDB-TSCRIPT-090929-10709
Name
fam43b-201
Previous Names
  • fam43b-001
  • zgc:92105-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028195 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028195|OTTDARG00000021989|ZDB-GENE-040912-11 fam43b|OTTDARP00000023059 DKEY-262N17.1-001 LG_ CR762407.8 Danio rerio protein_coding KNOWN, 2000 bp
CTTTGCTGTGCTTCTCTGAGAAACACACACACACCAGAAC
GCTCTTCATTGCTGCTTAAGGGAGAGTGCTGAATCCGTTC
CACTCTTTCAGGATCATGCTGCCCTGGAAAAGGAGTAAGT
TTGTGCTAGTGGAGAATGAGTCCAAAAGCAAGCCGAAAAG
TCTTGGAGCTGGGCTAACTTACCATTCGCTGCTGTCGACT
TTGCTCCACTCTTGTCCGGATCTCCTTCCCGACTGCCCGT
TCCACTGGTTGGGGAGCGTCTTCCACAGCAAACGGCAAAA
AGTGGAGCTTAATAAGGAGGAACCCACCTATAATGTGCGT
TACCTGGGCAGCGCGGTCACTATTGTGGCTAAAGGCGAGG
ACTGTACGCAGGAGGCGGTGGCTAAGATTTGGACCCGCAG
CAACTATGGCGAACAGAGCGCTAAGATGAAGATAACTGTA
GGGCCTCATGGGATACGCATGGGAGTTGATAAAAGTGGCA
AAAAGAAGCCTAGTCACCTCTTTTCTCTCAACCGGATCAC
GTACTGCACTGCTGATCCATTCCGGCCCAAGATATTCGCG
TGGATTTACAGGCATCAGGTGAAGAATAAAGCGGTGGTGC
TGCGCTGCCATGCTGTCCTATTGGCCAAGGCGGAAAAGGC
CAGAGCGCTAGCGCTCAGCCTCTACCAAAACACAACATCT
GCGTTCACAGAGTTCAAGAGGCTAAAGCGCCAATCTGACT
TCCGTCATTGCCAGCAGCAGCTGCTGGGTGAAGACATCGT
GCCTCTTATGCCTCTTCGGAGACTCCTGAATGGCCAATGC
CACTACCAGCCACCTGCAGAAAAGCCCGGGAGCGCCACAC
GACTTTCTTCGATTACAGAGGAAGAGGAGGATGAGGATGA
ACTGGGGGGTGCCCAATCCACAAACAGCAGTCCAGAGAAA
GAGAAAGATGTGGGGAAGATTGTAAATAGACTGGATGAGG
TTTCAGTTACCAGCTGGGATGAAGCACAGATGACTATCAG
CACTCTGGTGTGACATCACATGGATACAATTTAGTGTCCA
CACCACTGAGCCTCCGTCCTGTCGCCTATCCCGCCAACCC
ACTCTCTCTGGTACGTCCATTGATGCACCATGAAACAGCC
CTCCAAAAATTCGGGAGAATGACAGTCGGGCAGTGTTGCC
TACAGAGGAAGCGTTCTAGAGGGAAAGCCAGTAGAAGCAC
AATACAAGGAGGTCCACAGGTACGCCAATCATTCGGAATT
GGTGGAGAGCTTACACCGAAAAGCCTTTATCTATCCCCGA
CATCAAGCAAAGCTTAAACGGCACACCAAAAGACTGTAAA
GCATTCATCTCATACTCACAGCACCTAGTGATATTGTGAG
TACATGCCAAGTGCTTTAGACTGATGGACTATGTGAAGGA
ACTACTTTTTGTACAGCAAGTCTGTCTTTTGATGTTCATA
AGTCTGTCCCCCGGTGACCTCTCTCAGGAGCTCTGCTTCA
ATGGGATGCGGCTAAAGCTGGTTTATTGGCACTGGGAGCA
GCACTAATGAATTAAACCATAACTTAGGAATCGAGCCATT
GACTTGACATGTTTACTGCTACCATTCGTCATAGCTCTGC
TAATCAGTAATGCATAGCAAGTGGAGGCATCACCTGTGAC
GTTTGAAACGGGCCTTTTTAATAGCGTTTTTAAACCGTAT
CAATTTTACACTGTGATTTTGTCTGGGACCAACGAGAGCA
AAGTATATTGTGTTTATACTGACAAGCAGTTGTAATTTAT
GCTGAATTTGTGTCGGTGTATTGCGTTAGTCATGACAACT
CATTTTTATGCCGTTCACGTGAAGGTCGTAGCTTCCATCT
GTCAACTCTGGCATGTGTTTTTGTAATTTCAGCGCATCGT
ATTAATCTTCTGGAAAATGATTGGGAAACATTTTTCTACT
ACTTTCATTTTTTTCTGCACAATAAGACACAGTCAGTGTG
AAAAATTGCCATATGTTGTATAATAAAATGTTTGCTTATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations