ZFIN ID: ZDB-TSCRIPT-090929-10682
Transcript Name: alg6-201
Previous Names: alg6-001, alg6-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028167 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028167|OTTDARG00000021973|ZDB-GENE-040808-45 alg6|OTTDARP00000023038 alg6-002 LG_ BX664614.11 Danio rerio protein_coding KNOWN, 2011 bp
GCAATGTTTCAGGAAGTGAATTTCAGCTGCTGCGGCTCTG
CATGAAAGCATGAGAGATGTTACAGATTTATGAGTTTTAA
ATCAAAGGTCTTGAAGGCTACCAGACATGGAGAACTGGAG
CCTTATTTCTCTTTGCGTCTTGCTGGGTTTAACGTCGAGA
TGGGCAGTGTCTTTTCACTCTTACTCAGGTGCAGGTAAGC
CGCCAATGTTTGGGGATTACGAAGCGCAAAGACACTGGCA
AGAATTGACTTACAATCTACCCGTTCATGAATGGTACTTC
AACACTACAAATAATGACTTGAATTACTGGGGTCTTGATT
ACCCTCCTCTAACAGCCTATCACAGTTTGGCATGTGCATA
TATAGCAAAGCTGTTCAATCCTGAATGGGTGGAGTTGCAT
GCATCCCGAGGCTATGAAAGCCACTCTCACAAGTTGTTCA
TGAGGGCAACGGTGCTTTTTGCAGATGCTTTGATCTACAT
TCCAGCAGTTTTGCTCTACTGCTTCTATTTTTGTGATGGA
TCTCCTAAACAAAAGGTTGCCACAGCTTTCTGCATCCTTA
TGTATCCAGGACTTATGCTGATAGACTATGGTCATTTTCA
ATATAACGGTGTGAGCCTGGGTCTGGCTCTGTGGGGGGTT
TTAGGACTTGGTTTGGGCTGGGACCTGTTTGGTTCTGTGG
CCTTTGTCTTGGCTCTCAATTACAAGCAAATGGAATTGTA
CCATGCGCTGCCTTTCTTTTGTTACCTCCTGGGAAAATGT
GTCAAACACGGCTTAAATGGACAAGGGTGAGTTTCTTGGT
TTTTTGAATGAACACTGGATTTTTTTATTGAATATTGATT
TAAAGGAACAGTCCGCTCAAAAATTAACATGCTGTCATCA
ATTACAATCACATTGTGCCAAAATTATATAACTTCCTGTC
TTCTGTTGAACAAAAAAGAAGATATTTTAATAATGAATGT
TGGAAACCAGTAGCCATTGACTTCCATAGTATTTCCCCCT
TCTATGGATTTCAGTGACTTCTGCTTGTCAACATTCTTTA
AAATATCTTGTTTTGCACTCAACAGAAAAAGAAACACACA
AAGGCTTGGACCCTCCTAAACTGTGAGTACATTTTGTTTT
TGGGTGCATTCTTCCTTTAAATTATATATTAAAATAGAGT
AAATGTAATTAACTCTGACCTCAAGACAATTCTATACAAG
GTAATTAAGACAGACCTGGTGCAGAGACCTTGGAAGAGAA
ACATACATAGAACTGCAATATAGACCTGTCTTTTCTCATT
CTGTTTCAACACACAAATATTTAGATAACTTCTTGGAAGA
AAATATGAAAGGTAATTCCTGCCAATTGTAAATAAATCAA
ATAAACATTAGAAATTAAAATGAAAACCATATTAACAATT
TCATTATAAAATGCTGTTTGCAAAATATCTGCCAAAATTG
AAAATGAAATGAAATGTTTATCTAATCTTACTGCATTTTA
TTCACTTAAACATCACTTATTCTAATAAAGAGATAGTTGG
CCCAAAAATTATAATGATGTTCTCATCTAAAATTAAATTG
CATTATTAATTACTTATCTTCATGATCATCTTCAGAACAC
AAAATTTGCAAATAATTACCAATTATTGTATTAAACAGTA
ATTAATAACAATAATTTTCATTTTTGGGGTGAATTAACCC
TTTAATTATGCATTTGCAGGCTAGTTGATAAGCTAACAGT
GTCTTGTCTTGCATCATTAAGCAATGTTTTTTTATTAATA
TTATCAAAGGAATAATAAGTTTTTTTGATTATTTTTTTTT
TTATTTAAATCTAAGAAATGTGAATTATTGAAAAGCCCCC
TTAATGGAAAACTGCCCATTGTTATTCTGGAAAATGTATA
AAAAAATATGTTTGTATACCTAATAATCAAGTTAAGGGTA
CAGTGCAGTTGATAGTGTCATTTGTCTATCTGCCTGATTT
GTGTTAAATAATGACAATACAACAAACAGTTGATATCTAT
TGTTCTGCACT

alg6 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA alg6-201 2011
alg6-202 (1)    Ensembl 1944
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
alg6-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000028167 (1),  Ensembl_Trans:ENSDART00000130627 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC079496 (1) 2080 nt
GenBank:CK681377 (1) 571 nt
GenBank:CK709499 (1) 289 nt
CITATIONS (2)