ZFIN ID: ZDB-TSCRIPT-090929-10595
Transcript Name: stxbp2-201
Previous Name: stxbp2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028064 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028064|OTTDARG00000021915|ZDB-GENE-040426-2482 stxbp2|OTTDARP00000022967 stxbp2-001 LG_none AL954361.7,CR388169.8 Danio rerio protein_coding KNOWN, 2529 bp
CAACAGGGAAGTGTCAAGATGGCCCCGAGTGGACTAAAAG
CGATCGCGAACGAAAAAATCCTCAGTGGAGTCATCAAGAG
TGTGAAGAAAGATGGGGACTGGAAGGTGCTCATCGTTGAT
CATATCAGTATGCGGATTCTGTCCTCGTGCTGTAAAATGT
CTGACATCATGGCAGAGGGTGTTACAATTGTGGAGGACAT
CAGCAAACGAAGGGAGCCGATCCCCAGTCTGGAAGCCATT
TACCTCATCTCACCTGTGCCAAAGTCAGTTCATGCTCTGA
TTGCGGATTTCAGAGAGACAGCCTTCACTTACAAAGCAGC
ACACGTCTTCTTTACCGACACTTGTCCTGATGGGCTTTTT
GCTGAGATTGGCAGGTCGAGGGTTGCAAAGGTCATCAAAA
CTCTCAAGGAGATCAATGTGGCTTTCATACCGTATGAGTC
TCAGGTCTTCACTCTGGACAACCCCAGTTCCTTCCACGCT
TTCTACAGCCCAACTCAGACTAATCTAGATGACAAGAGCA
GAATGATGGAGGCCATGGCTGAGCAGATCGCCACTCTCTG
TGACACGCTGACGGAGTATCCAGCCATCCGATACCGCCTG
GGGCCAAAGGAGAATTTCAGCCTGGCTGAGATGGTGATGG
ATCGTCTGAATGCACACAAAGCAGACAATCCCAGAATGGG
AGAGGGCACAGATAAAGCTCGCTCTCAGCTGCTAATAGTG
GACCGTGGGTATGATCCCGTCTCTCCAATTCTTCACGAGC
TCACCTTCCAGGCGATGGCCTACGACCTGCTAGACATTGA
ACAAGACATTTACAGGTATCAGACAGCAGGGATCGGTGAG
GCTCGAGATAAAGAGGTGTTGCTGGATGAGGATGATGAGC
TGTGGGTTCAGCTGCGACACATGCACATAGCAGACGTCAC
CAAGAAGGTGACAGAGCTGCTGCGGGTCTTTTGTGACAGC
AAGAGGATGAACACAGACAAGGCCAACATCAAAGATCTGT
CTCAGATGCTGAAGAAGATGCCGCAGTACCAGAAAGAGCT
GAGCCTGTACTCCACTCATCTGAACCTGGCTGATGCTTGC
ATGAAGAAGTTCAAGAACACGTTAGACAAGCTGTGTGAGG
TGGAGCAGGATTTGGCCATGGGATCAGATGCCCAGGGCGA
ACCGCTTAAAGATGCTATGAAGAGTATCGTCCCTGTTCTT
CTCAACACAGAGATCAAAGACTATGATAAAATCCGCATCA
TACTGCTGTACATCTTCCACAAGAAGAAGGGCATCGGTGA
AGAGAACCTCACAAAGCTCATCCAGCATGCAAACGTTCAG
CAGGACAAGAACATCATCACCAACCTGCAGCATCTAGGCT
GCCCTATCATCACTGGGGGTGCTAATTCTGGAAAGAGTCT
GCCTGACAGGAAAGAGCGCACAGAATCTACATATCAGCTC
TCCCGCTGGATACCCGTCCTGAAAGATGTGATGGAGAATA
TCATTGATGACAAATGTGACAGGAAGCAGTGGCCATTCCT
GTCTGAGCCTGCACCCATCACCACCACCGCAACTACAGTC
AGCAGCGCACGGTTTGGACACTGGCACAAGAACAAGTCTG
CCACAGAGTACCGCAGTGGCCCTCGCCTCATCATCTTCGT
GATTGGAGGAGTCACACATTCAGAGATGCGCTGCGCTTAT
GAAGTGACCCGCGCCACTGAGGGCAAATGGGAGGTTCTGA
TCGGATCGTCTCACATTATTACTCCAACCAGCTTTCTGAA
TGACCTGAAGGAGCTGGACGCGTCTGCAACAAGTGTTGCA
CAGTAACCCCCTCTCACAGATTCATCCCACATGTGAACAT
TAAGAGTTTCTCCAATGACCAGTGAAAAAAAGACACATTT
TAAATCTGCCTCACTGATTATTTGCTGTCTTTTAAAGTAA
TGATTTTAATTACGCAAATTAACTGGTGGTATATGTGTGT
GTATATATATTCATGACCTATGCTTAATTTAAAAGAACAA
TTATATGTAAGACCACATATGTGAACGTAATTAGAATTCT
GAGGCTGGAAATTGTCCACATAAATGGATTAAATCTCGCT
CCGCTCCATTGAAATGCCAGTCCTGTCAAGTTTTGATGTG
ATTTAAGGACTTCTTTAGACCTGCACACTGGAACGAATGA
TCACACTGGATTTAGAGATATTATCTATCGCCTTGTGATT
TATCATAAAGAATATACATTTTTATCTTACTTTAAAACTG
CCAATGTGAAAACTTAAGGTATTTAAGATGAGGCTGTTTG
TAGTAGAGCTGTCCAATTTTGATTTCCAGTCAGGTTTGGT
TATATCTGCCTCTCTTGGTGAAGGGATGAAATGTGTCATC
TCAGTATATATACAGTATGTCTTTTTTGTTTGTTATGCTC
TGAACTTGTGCACTTTTTTTCTTATACTGTTACTGTATCA
CATATAGATGGATGTGGTTCACTGGGTCTATTTGTCTTTT
GTTTCTGTTAACATTAATTCTAAATAAAATTTGCTTATAC
CTCATTCTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
stxbp2-201 Contained in:
[BAC] CH211-280H11 (1), DKEYP-61H1 (1)

Genome Resources: Vega_Trans:OTTDART00000028064 (1),  Ensembl_Trans:ENSDART00000031234 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC068392 (1) 2542 nt
GenBank:DV586150 (1) 843 nt
GenBank:AW232255 (1) 417 nt
CITATIONS (2)