Transcript

asna1-201

ID
ZDB-TSCRIPT-090929-10491
Name
asna1-201
Previous Names
  • asna1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027958 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027958|OTTDARG00000021841|ZDB-GENE-040625-120 asna1|OTTDARP00000022876 asna1-001 LG_ BX901942.6 Danio rerio protein_coding KNOWN, 4613 bp
TCCGTTCGTAACTGTTCACCCTACAAAGGACATCTTGAAT
CTAATCTTCCTCTATAACTAGCGTTCTCGCTTCCTTGGCT
GAGCCAAAATGGCGGAGTGTGCAGATACTGCATTGGTGTA
TTCCGACTGACTTGAGCGCAAGATGGCAGCTTCAGTGGAA
GACGAGTTTGAGGATGCCCCTGATGTAGAGCCTTTAGAGC
CGACCTTAAAGAATATAATAGAGCAGAAATCACTTAAATG
GATATTTGTCGGCGGTAAAGGAGGTGTGGGAAAGACGACA
TGCAGCTGCAGTCTGGCGGTTCAGTTGGCGGCGGTGAGGG
AAAGCGTCCTCATCATATCCACAGATCCAGCACACAACAT
CTCAGACGCCTTTGACCAGAAGTTCTCCAAGGTTCCCACT
AAAGTCAAGGGCTACGACAACCTCTTTGCTATGGAGATCG
ACCCCAGTCTGGGTGTGGCAGAGCTGCCGGATGAGTTCTT
CGAGGAGGACAACATGCTCAGTATGGGGAAAAAGATGATG
CAGGAGGCCATGAGTGCTTTCCCTGGCATCGATGAGGCCA
TGAGCTACGCAGAGGTCATGAGGTTAGTGAAAGGCATGAA
TTTCTCAGTAGTGGTGTTTGACACGGCTCCCACAGGACAC
ACTCTGCGTCTGCTCAACTTCCCCACCATCGTGGAGCGAG
GTTTGGGACGCCTCATGCAGATCAAGAACCAGATCAGCCC
CTTCATCTCACAGATGTGTAATATGTTGGGCCTGGGAGAC
ATGAATGCAGATCAGCTGGCGTCCAAACTGGAGGAGACGC
TGCCTGTCATCCGCTCCGTCAGCGAGCAGTTCAAGGACCC
GGAGCAGACAACGTTCATCTGTGTGTGCATCGCAGAGTTT
CTGTCTCTGTACGAGACGGAGCGTCTGATTCAGGAACTTG
CCAAGTGTCGCATCGACACACACAACATTATCGTCAACCA
GCTGGTTTTCCCTGACAATGAGCGGCCTTGCAAGATGTGT
GAAGCCCGACACAAGATTCAGTCAAAGTACCTGGACCAGA
TGGAGGATTTATATGAAGATTTCCACATAGTAAAGTTGCC
TCTGCTTCCTCACGAGGTTCGAGGAGCCGACAAGGTCAAC
ACTTTCTCCAAGCAGCTGCTGGAGCCCTACAGCCCTCCCA
AAAAGTGACTTAAACCATTCCCACGGATCAAACACACACC
TCTTCTACACTCGCGCACAAACCCACTGTCTCTCTACTAT
CTGGTTTTCAGCTAATGCGCTAATTGACGCCGCTCCAGTG
ATCCGTAATGAATGTTGGGCAAGATTTAAAGGGACAGTTC
ACCCAAATAAAGTTCATTTTTACTCTCCCTCAAGTACTTG
CAAACATTTATGAGCTTCTTTTTTCCATTGAACACAAAAG
AAGATATTTTGAAAAATGTTGAAAACTGGTAAGCATTGAC
TTCCATAGTAGTAAAAACAAATGGAAGTTATTCATTGCAA
CATTTAAGAACACTATTTACTCTCCCTCACATGCTTGCAA
ACATTTAAGTACTTTTTCTTCCATCGAACACAAGACATTT
TGAAGAATGTCAAAAACCGGTAACCATTGACTTCCATAGT
AGGAAAAGCAAATGGAAGTTGATGGTTACAACATTCATCA
GTTCTATCTATGCTCCCTTTAATGCTTCCAAGCATTTATG
AGCTTCTTTCTTCCTTTGAACTCAAAAGAAGATATTTTGA
TAAATGTTGAAAACCGGTCACCATTGACTTGCAAAGTTGG
AAAATCTAATGGAAGTTAATGGTTACAACATTCATCAACA
CGATCTACTCTCCCTCAAGTGTTTGCAAACATTTATGAGC
TTCTTTCTTCCATTAAACAGAAAGGAAGGTATTTTGAAGA
ATGCTGAAAACTGGTAACCATAGACTTCCTTTGTAGGCAA
AACTAATGGAACAACTGAAAAGTGAGTTAATAATGATAGC
ATATAAATTTTGGAGTGAACGGTCCCTTTTAAACGGCCTG
TTTAGAAACACACTTGATGATTTGTTGCTTTATGATGACG
GTGTTTGTATTTAAGCGTGAGAAAACACTCATTCCTGTTG
TGTGTTCAAGCAAAGACATCAAATTGATATGAATTCAGCG
ATTAAACATCAGAAAAAATGGTCTCTAGTTAAGATTCATC
TGATTTCGGATCAGTAAAAGACACCATAAACCTGTGATTG
CGATTCTGCTCACCGTTAATTGACTTTATTTTGGGTTCCG
GACTGTGTGTTTAGTTTGAGAGGGTCCAAACTTAAAGGGA
CAGTTTGCCTAAAAGTACAAATTCTGCCATTTTACTCATT
GCTTGTTTTAAACCTATATGAGGTTAAACGCAAAAGAAGA
TATTTTGACGAATGTTGGCGCTTACTGATTTCAATAGTAT
TTTATTCTACAATGGAAGTCAATAGGTGCCAACATTCTTT
AGAATATCTCCTTCTGTGTCCAACAAAATCTCATAAAGGT
TTAAGAGAAGAGTAAATGATCAGGTACTTTGTAGTTTTTG
GGTGAACTTTCCCCTTTTAATGGGCATAACGCATATTTTA
GTGAGTCATTAAAAGATTAGTTCACCCCAAAATAGTTCAA
TTGACATTATTTACTTGTTTTGTTCTTTTAAATGCAAAAT
GAGAGAGATTTTGAAGAATGTTCATCTGATTTCGGATCAG
TAAAAGACACCATAAATCAGTGATTGCGATTCTGCTCAGC
GTTAATAGACTTCATTTTGGATTCCGGACTGTAGTTTTGT
CATCTGAGAGAGTCCAAACTTGAAGGAATAGTTCGCCCAA
ATTGCAAATCCTGTCATTTACTCATCTTTCATTTGTTCAA
AACCTATATGAGATTTCCTCTGAGAAGCACAAAAGAAGAT
ATTTTGAAGAATGTTAGCACTTATTGACTTTAATAGTATT
TTATTTTACTATGGAAGTCAATAGGTGCCAACATTTCTTT
AGAATATCTCCTTTTGTGTTTAACAATCTCATAAAGATTT
AAAAGAAGAGTAAATTATTGGTTAATTTGTAGATTTTGGG
TGAACTTTTCCTTTTAATGGGCATAATGCATATTTTAGTG
AGTCGTTAAAGAGAATTAGTTCACCCAAAAAAGTCCAATT
GTCATTTATTAACTTGTTTTATTCTTTATAATGCAAAATG
AGAGATAGTTTGAAGAATGTTGTATGAATCTTTTTTTTAC
GGATCTCTTTTTGTGTTTAACAGAAGAAAGAAACTCGAGT
AGAGGGTGAGTTAATAGTGACAGATTATACATTTTTGAGT
GAACCGTCCCTTTAAATGGCCTGTTTAGAAACACACATGA
TGGTTTGTTGCTTTATGATGACTGTGTTTGTATTTAGGCG
TAAGAAAACACTCATTCTTGGTGTGTGTTCATGAAAGGAC
ATCAAATTGATATGAATTCAGCAATTAAACAGTGTAACTA
GTCTCTAGTTTAGATTCATCTGATTTCGGATCAGTAAAAG
ACACTATAAACCTGTGATTCAAATTTTGCTCAGCGTTTAT
AGACTTTTTTTTTGGGTTCCGGACTGTGTTTTTAGTTGAG
AGGGTCCAAACTTTAAAGGGGTATTTCACCCAAAATTGCA
AATTATGTCATGTACTCATTCTTTAAAACCTATATGAGGT
TTTTTCCTCTGTTAAACACAAAAGAAGATATTTTGAATAA
TGTTGGCACTTATTGACTTCTGTAGTATTTTTTTTTATAT
ATGGAAGTATATAGGGGCCAACATTCTTTAAAATATCTTC
TTTGGTATCCAACAAAATCTCATAAAGGTTTAAAGGAAGA
GTAAATCGTCAGGTAATCTGTAGTTTTTGGGTGAACTAAT
CCCTTTTAAGGGTCATATCGCATATTATAGTGAGTCGTTA
AAGAGAAGTAATATCCGATTGACATTTTTTTTTTACTTGA
TTTAATCTTTCATAATACAAAATGAGAGATATTTTGAAGA
ATGTTGTGTGAAAATTCTGACAAAATCTCTCTTTGTGTTG
CATTAGACAAATATGGATTGCATAAAATGAGTAAATAATG
CCTAAAACCCCCATTTTTGGGGATGAACTGTTCTTTTAAA
CTCGCATTTAATCAACTTCTTCTCGCAATGCATCAGTTGT
AATTACCATGTACAAATGTTGTGATTTCAAGATATCTAAT
TTAATTTTTTGCAGTTTAAGTGGCGTATTTATATAGACTT
CTAAGATGCTTTCTGTTCAGATCTTACAGCTTCTATCGCA
TTTACTTGGGAGATTTAGTTCTTCATCTCAGCTCTTCTTC
AGGTTGTTTGGCTGTGATGTCCGCATGCATCAAAACACAG
GTACAAACACCTACAAGGAGATCAGAAGCTCATTTAAACA
CTGCAGGATACCATCAATACTATACTCTACTTGACATTAC
ATGTGTTTACTTGCTTTTCATCATTCTGTGGTTTCACGGC
TTGAAGTAAGAGCTCACAAATATAGACAGAGAGATTTCAG
TAATTCATTAGTCGTCAGTCAGTTTTCTTAAGGTTTTGTT
TCTTATGACTTGTTACTGCCTTTACAAATTTGGCTTCTTT
TTGTAGAAGCGCACCAAGTTTCAAAGCAAATAAACTCTCC
TCCATCTACTGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations