header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10470
Transcript Name: cab39l-201
Previous Name: cab39l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027937 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027937|OTTDARG00000021832|ZDB-GENE-041114-204 cab39l|OTTDARP00000022863 DKEY-7A20.4-001 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 3012 bp
GAGATCAGCTCGCAGATTTTACACCAAAGCACAGCAAACC
GACACACGGCCGATCCCAGATCATTGGCAAGCCACTCGAG
AGGACGTTGGTTACAAATCACCCATCATGTCTTTTGCAGA
TATTCGCGTTTGAGTCAGTCAGTGTTAAATTCGCTCATAC
ACACATTCCGCTGACGTTTAGCCCAGAGCGCGCGCACACA
CACACAGAAGAGAGAAGAGTCTGCTGGCGTGATCAGGAGG
ACTGTCGCTTGCTAACACACACACATATACAAAACACCAC
AGCAGCCGCAGAAGAGGACACGATTACATCGCAGTGTTGT
GAAGAAAGAAGTCTACGGCCGCTACCATGCCACTCTTTGG
TAAATCTCACAAAAGTCCCACAGAAATTGTGAAGACTTTG
AAGGACAACCTCTCCATCCTGGTCAAGCAGGACAAGAAGA
CAGAGAAGGCTTCAGAAGAGGTGTCGAAGTGTCTGGTGGC
AATGAAGGAGATCCTGTACGGCACCAATGATAAGGAGCCG
CACACAGAAACCGTGGCTCAGCTGGCCCAGGAGCTCTACA
ACAGCAGTCTGCTCATCTCACTAGTGGAGAACCTGCAGGT
CATCGACTTTGAGGGTAAGAAGGATGTCTGTCAGATCTTC
AACAACATCTTGCGTCGTCAGATCGGGACCCGCAGCCCGA
CAGTGGAGTATTTCTGCTCCCATCAGGAAGTGCTCTTCAT
CTTACTCAAAGGGTATGAGACTCCTCAGGTGGCGTTGAAT
TGTGGGATTATGCTGCGCGAGTGTATCCGGCATGAGCCTC
TCGCCAAAATCGTCCTCCATTCTGAACACTTCAAAGATTT
CTTCAGCTATGTGGAGATGTCCACATTCGACATCGCATCT
GACGCATTTGCCACTTTTAAGGACCTGCTTACGAGACACA
AGGCTCTGGTGGCTGAGTTTTTAGAACAGAACTATGATGC
GGTTTTCGATAACTATGAGAAACTGCTTCACTCCGAGAAC
TACGTGACCAAGAGACAGTCGCTGAAGCTGCTGGGTGAGC
TGCTCCTTGACAGACACAACTTCACGGTCATGACGCGGTA
CATCAGTAAACCAGAGAACCTGAAGCTCATGATGAACCTG
CTGAGAGACAAGAGTCCCAACATCCAGTTTGAGGCCTTCC
ACGTCTTCAAGGTGTTCGTGGCCAATCCAAATAAAACGCA
GCCCATCGTAGACATTCTGTTGAAGAACCAAACCAAACTC
ATCGACTTCCTTAGCAACTTTCAGAAGGATCGCACAGACG
ACGAGCAGTTCAACGATGAGAAGACATACCTGGTCAAACA
AATACGAGACCTAAAGAAACCGGCCTCCTAAACTCTAGCT
ACTTCAGTATTAGGAAAACAAACAAAACACACACACACAC
ACAAAAAATTATATTAACAATAATAATTCTATTTAAAATC
TCGACAGATTTGTCTTTTCTTAGTTCTGAGGCTTACAAAT
TCCTCATCGTTGACGTTCTCCGTTTCTTATTTTGCGTTTC
CCCCTATCGTGATTTTGATTTAATCGCGAACGTTTTTGTG
CCATGAATAGGATGTTTTAAAAGTAGGAATCAGCCAGTTT
GAATTGCAGGAAGAATCGACTTCGAGATTCGTCTCTCTGC
GGATGAGGAAGTACAGGTAAACTTTCACTCCTCCGTTTCT
GGATGTTTCTTTCTCGGTTCCTGGAGACTCGACGTGACTG
AAAGTTTGCGTTTAATTGCTGGAGAAGATGAAGAGCTGTT
GATTTCCTCTCTGTAACTGCACTAATCCTGCTTTGTCCAG
CTCTTATTTCCACGACACTACCAACCTGATCATTTCCTCT
CTGTTCTGTTTGTGTTTCATTTAAGAAGGAAGAATTCATT
TATCAGTATTTTAATGATGGTTTATCTGAAGCAGGAAGAG
CGTCTGTGGGTCTTTGTGTACAAATTTTCCTCTCGTTTTC
TTATTACTATTCTTATTTTATATATTTTTACTTCAGTTTT
TTTTTTTAAACACGCTGATTTTACTCTTTAAGGTGGTTGC
CATTTTTATTTCGAAAGAAGAAGAATCTTGAAAAATCAAC
TTTGGCACTAAGTGAACCGGTGTAAATTCCAGCTCTAGAT
TTCAATGTAGATCAATGAGGGTTTTCTCCTGTAGCGCTTT
GGTTTTACTATAGTATCCTCAGCGCTATAGTATCTTAACT
TTAGTGCGTCAGACTGAAGTACTTCTTTATACTGTAGTGC
AGCTGTAGTGTTATACTATAGTATTTCATTTTACTGTAGT
ATGTATTTTGTGCTATAACCCATAATTCAGCTGTCTTTGA
TGAATTGGACAGAAGTAGATTGTTGCATAGCTGAAAATCA
GATGAAATGAGGACGCAAATGTATAAAACAGGTGCCTTTT
TGTTCTTTTTATTATTATTATTATTATTATTATTTGAGAT
TAAATATTGGAAGGGGGAGCTTAATTTCTTTTTATTGTTT
TAAATATGTTCTGATTGGGCATATTTCGCTTGATTAAGCA
ATGAACCTCTTTAACTCACTATATTGGAGTTATGCTGTTG
AAGAAAATTCATTAAATTTGATTCTGTTTTTCCTCTTTGG
TTGATCGATTCAGTTTATTTTTATGACGTGTTTTGTTTGG
GATGAAATATGCTTTGAGGTTTGGATCTGTCGCCCGTAAA
GAGAAGAAAAACCCATTTCTGTTCTCTTAAGGCAACTGTT
TTCAACTCTTAAATCCGTCTGAGCCACATTTATTGAATAT
TTGTCAGCCTTTACATTGAAAATGCCAAACCGTGTGTTCA
CAATATGAAGTCAAAATCTTTCCTACTACAAACACCGGTG
CGGTTTTCATCTGAAATGCTAAAAGTACCGTATCAATAAA
GATCAAGTGAAGCATTAGCAGCATCATTGACTCATTTTTT
CCCCCCAAAAAAATGCAATAGTGCAAATTTGTGCTATGTA
AATTAAATTCTCCATTTTCAATAAATATATTTCACACGAG
CACATGATGAAA

cab39l TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cab39l-201 3012
cab39l-202 (1) 1238
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cab39l-201 Contained in:
[BAC] DKEY-7A20 (1) (order this)

OTHER cab39l-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027937 (1)
  • Ensembl_Trans:ENSDART00000053240 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC085674 (1) 2528 bp
    GenBank:CT685658 (1) 800 bp
    GenBank:EB871469 (1) 458 bp
    GenBank:AW567115 (1) 445 bp
    GenBank:CT599797 (1) 266 bp
    CITATIONS (2)