Transcript

cab39l-201

ID
ZDB-TSCRIPT-090929-10470
Name
cab39l-201
Previous Names
  • cab39l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000027937 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027937|OTTDARG00000021832|ZDB-GENE-041114-204 cab39l|OTTDARP00000022863 DKEY-7A20.4-001 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 3012 bp
GAGATCAGCTCGCAGATTTTACACCAAAGCACAGCAAACC
GACACACGGCCGATCCCAGATCATTGGCAAGCCACTCGAG
AGGACGTTGGTTACAAATCACCCATCATGTCTTTTGCAGA
TATTCGCGTTTGAGTCAGTCAGTGTTAAATTCGCTCATAC
ACACATTCCGCTGACGTTTAGCCCAGAGCGCGCGCACACA
CACACAGAAGAGAGAAGAGTCTGCTGGCGTGATCAGGAGG
ACTGTCGCTTGCTAACACACACACATATACAAAACACCAC
AGCAGCCGCAGAAGAGGACACGATTACATCGCAGTGTTGT
GAAGAAAGAAGTCTACGGCCGCTACCATGCCACTCTTTGG
TAAATCTCACAAAAGTCCCACAGAAATTGTGAAGACTTTG
AAGGACAACCTCTCCATCCTGGTCAAGCAGGACAAGAAGA
CAGAGAAGGCTTCAGAAGAGGTGTCGAAGTGTCTGGTGGC
AATGAAGGAGATCCTGTACGGCACCAATGATAAGGAGCCG
CACACAGAAACCGTGGCTCAGCTGGCCCAGGAGCTCTACA
ACAGCAGTCTGCTCATCTCACTAGTGGAGAACCTGCAGGT
CATCGACTTTGAGGGTAAGAAGGATGTCTGTCAGATCTTC
AACAACATCTTGCGTCGTCAGATCGGGACCCGCAGCCCGA
CAGTGGAGTATTTCTGCTCCCATCAGGAAGTGCTCTTCAT
CTTACTCAAAGGGTATGAGACTCCTCAGGTGGCGTTGAAT
TGTGGGATTATGCTGCGCGAGTGTATCCGGCATGAGCCTC
TCGCCAAAATCGTCCTCCATTCTGAACACTTCAAAGATTT
CTTCAGCTATGTGGAGATGTCCACATTCGACATCGCATCT
GACGCATTTGCCACTTTTAAGGACCTGCTTACGAGACACA
AGGCTCTGGTGGCTGAGTTTTTAGAACAGAACTATGATGC
GGTTTTCGATAACTATGAGAAACTGCTTCACTCCGAGAAC
TACGTGACCAAGAGACAGTCGCTGAAGCTGCTGGGTGAGC
TGCTCCTTGACAGACACAACTTCACGGTCATGACGCGGTA
CATCAGTAAACCAGAGAACCTGAAGCTCATGATGAACCTG
CTGAGAGACAAGAGTCCCAACATCCAGTTTGAGGCCTTCC
ACGTCTTCAAGGTGTTCGTGGCCAATCCAAATAAAACGCA
GCCCATCGTAGACATTCTGTTGAAGAACCAAACCAAACTC
ATCGACTTCCTTAGCAACTTTCAGAAGGATCGCACAGACG
ACGAGCAGTTCAACGATGAGAAGACATACCTGGTCAAACA
AATACGAGACCTAAAGAAACCGGCCTCCTAAACTCTAGCT
ACTTCAGTATTAGGAAAACAAACAAAACACACACACACAC
ACAAAAAATTATATTAACAATAATAATTCTATTTAAAATC
TCGACAGATTTGTCTTTTCTTAGTTCTGAGGCTTACAAAT
TCCTCATCGTTGACGTTCTCCGTTTCTTATTTTGCGTTTC
CCCCTATCGTGATTTTGATTTAATCGCGAACGTTTTTGTG
CCATGAATAGGATGTTTTAAAAGTAGGAATCAGCCAGTTT
GAATTGCAGGAAGAATCGACTTCGAGATTCGTCTCTCTGC
GGATGAGGAAGTACAGGTAAACTTTCACTCCTCCGTTTCT
GGATGTTTCTTTCTCGGTTCCTGGAGACTCGACGTGACTG
AAAGTTTGCGTTTAATTGCTGGAGAAGATGAAGAGCTGTT
GATTTCCTCTCTGTAACTGCACTAATCCTGCTTTGTCCAG
CTCTTATTTCCACGACACTACCAACCTGATCATTTCCTCT
CTGTTCTGTTTGTGTTTCATTTAAGAAGGAAGAATTCATT
TATCAGTATTTTAATGATGGTTTATCTGAAGCAGGAAGAG
CGTCTGTGGGTCTTTGTGTACAAATTTTCCTCTCGTTTTC
TTATTACTATTCTTATTTTATATATTTTTACTTCAGTTTT
TTTTTTTAAACACGCTGATTTTACTCTTTAAGGTGGTTGC
CATTTTTATTTCGAAAGAAGAAGAATCTTGAAAAATCAAC
TTTGGCACTAAGTGAACCGGTGTAAATTCCAGCTCTAGAT
TTCAATGTAGATCAATGAGGGTTTTCTCCTGTAGCGCTTT
GGTTTTACTATAGTATCCTCAGCGCTATAGTATCTTAACT
TTAGTGCGTCAGACTGAAGTACTTCTTTATACTGTAGTGC
AGCTGTAGTGTTATACTATAGTATTTCATTTTACTGTAGT
ATGTATTTTGTGCTATAACCCATAATTCAGCTGTCTTTGA
TGAATTGGACAGAAGTAGATTGTTGCATAGCTGAAAATCA
GATGAAATGAGGACGCAAATGTATAAAACAGGTGCCTTTT
TGTTCTTTTTATTATTATTATTATTATTATTATTTGAGAT
TAAATATTGGAAGGGGGAGCTTAATTTCTTTTTATTGTTT
TAAATATGTTCTGATTGGGCATATTTCGCTTGATTAAGCA
ATGAACCTCTTTAACTCACTATATTGGAGTTATGCTGTTG
AAGAAAATTCATTAAATTTGATTCTGTTTTTCCTCTTTGG
TTGATCGATTCAGTTTATTTTTATGACGTGTTTTGTTTGG
GATGAAATATGCTTTGAGGTTTGGATCTGTCGCCCGTAAA
GAGAAGAAAAACCCATTTCTGTTCTCTTAAGGCAACTGTT
TTCAACTCTTAAATCCGTCTGAGCCACATTTATTGAATAT
TTGTCAGCCTTTACATTGAAAATGCCAAACCGTGTGTTCA
CAATATGAAGTCAAAATCTTTCCTACTACAAACACCGGTG
CGGTTTTCATCTGAAATGCTAAAAGTACCGTATCAATAAA
GATCAAGTGAAGCATTAGCAGCATCATTGACTCATTTTTT
CCCCCCAAAAAAATGCAATAGTGCAAATTTGTGCTATGTA
AATTAAATTCTCCATTTTCAATAAATATATTTCACACGAG
CACATGATGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations