header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10471
Transcript Name: cab39l-202
Previous Name: cab39l-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027938 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027938|OTTDARG00000021832|ZDB-GENE-041114-204 cab39l|OTTDARP00000022864 DKEY-7A20.4-002 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 1238 bp
GCTGTTGGTGACTCACAGTTTCAGTGTTCGCGACACACAC
ACACACACACACACACTGCCCGCACACGCAGACTTTGACT
GCGACACTGTCGTTCAATAGTTCAGCAGGTGTATGACGCG
ATACTCCAAAACGTCGTGATTCAAAACCATGAGTCATGCG
CTTTATTTTTCGCCAGTATCTCTCCATAATAACACAGTCT
GAACACATCCACATCCGGGTAACGCGCCTCGCTGAGGGAG
GAAACCGCGCGCCATCTGACCTGAGATCAGCTCGCAGATT
TTACACCAAAGCACAGCAAACCGACACACGGCCGATCCCA
GATCATTGGCAAGCCACTCGAGAGGACGTTGGTTACAAAT
CACCCATCATGTCTTTTGCAGATATTCGCGTTTGAGTCAG
TCAGTGTTAAATTCGCTCATACACACATTCCGCTGACGTT
TAGCCCAGAGCGCGCGCACACACACACAGAAGAGAGAAGA
GTCTGCTGGCGTGATCAGGAGGACTGTCGCTTGCTAACAC
ACACACATATACAAAACACCACAGCAGCCGCAGAAGAGGA
CACGATTACATCGCAGTGGCCTGCATTTCAGCACGAACTC
GCACCATATATCAGTCTGACAGATGCTGACAACTCTCTCT
GCTTTCCTTGAAACACACTGAGGTTGTGAAGAAAGAAGTC
TACGGCCGCTACCATGCCACTCTTTGGTAAATCTCACAAA
AGTCCCACAGAAATTGTGAAGACTTTGAAGGACAACCTCT
CCATCCTGGTCAAGCAGGACAAGAAGACAGAGAAGGCTTC
AGAAGAGGTGTCGAAGTGTCTGGTGGCAATGAAGGAGATC
CTGTACGGCACCAATGATAAGGAGCCGCACACAGAAACCG
TGGCTCAGCTGGCCCAGGAGCTCTACAACAGCAGTCTGCT
CATCTCACTAGTGGAGAACCTGCAGGTCATCGACTTTGAG
GGTAAGAAGGATGTCTGTCAGATCTTCAACAACATCTTGC
GTCGTCAGATCGGGACCCGCAGCCCGACAGTGGAGTATTT
CTGCTCCCATCAGGAAGTGCTCTTCATCTTACTCAAAGGG
TATGAGACTCCTCAGGTGGCGTTGAATTGTGGGATTATGC
TGCGCGAGTGTATCCGGCATGAGCCTCTCGCCAAAATCGT
CCTCCATTCTGAACACTTCAAAGATTTCTTCAGCTATGTG
GAGATGTCCACATTCGACATCGCATCTGACGCATTTGC

cab39l TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cab39l-201 (1) 3012
cab39l-202 1238
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cab39l-202 Contained in:
[BAC] DKEY-7A20 (1) (order this)

OTHER cab39l-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027938 (1)
  • Ensembl_Trans:ENSDART00000132861 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK693005 (1) 740 bp
    GenBank:CO353268 (1) 680 bp
    GenBank:CT680590 (1) 658 bp
    GenBank:CK677284 (1) 522 bp
    GenBank:CD592002 (1) 500 bp
    GenBank:CD586338 (1) 317 bp
    CITATIONS (2)