Transcript

rab18a-202

ID
ZDB-TSCRIPT-090929-10402
Name
rab18a-202
Previous Names
  • rab18a-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000027863 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027863|OTTDARG00000021792|ZDB-GENE-030131-3980 rab18a|OTTDARP00000038264 DKEY-208M10.1-002 LG_ BX465854.7 Danio rerio protein_coding KNOWN, 791 bp
CGACAGAGTTTATCCGAAGAAGAGAGAAACGTTTAGCCCT
CGGATGATTTTTTCTCCTTTCTATTTGATTTGTATTTACA
CCGTCAGTGTTTTTGCTCATAGAGGCATTTTCCGGTGAAA
ATGAATGATGATATATTGACCACTCTGAAAATACTGATCA
TTGGCGAAAGTGGAGTAGGCAAATCCAGGTGTGGATTTCA
AGGTGAAAACGCTGGCTGTAGATGGAAACCGAGCAAAACT
AGCAATCTGGGATACAGCAGGTCAAGAACGTTTTCGGACT
TTAACACCCAGTTACTACAGAGGAGCTCAGGGTGTCATTC
TGGTGTATGATGTCTCTAGGCGAGAGACATTTGCTAAGCT
GGATAATTGGTTGAGTGAGCTGGAGACGTACTGTACAAGA
AATGATCTTGTCAAGATGCTAGTGGGAAACAAAATCGATA
AGGATGATCGTGAGATTGAGCGAGAGGAGGGCCTGAAGTT
CGCAAGAAAACACTCCATGCTTTTCATAGAGTCCAGTGCT
AAAACAAGGGATGGTGTCCAGTGTGCCTTTGAGGAGCTGG
TGGAGAAAATCCTGCAGACTCCAGGCTTGTGGGAGAGTAT
GCATAAGTCAAGAGGAGTTGCCCTGTCTGAACTCTCTGAA
AGTAGTCAAGGAGGCTGCGGGGCGTACTGCTCACTTCTCT
AACACGCACACTGGTGTTTAGACAGTGCAGGTTAGATTAG
TTAACCCATACAAAGGATACATATGCCTTTTTGGTAAGTG
TATCCCCGCGAGCACACAAACAAAACTTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations