Transcript

rab18a-201

ID
ZDB-TSCRIPT-090929-10401
Name
rab18a-201
Previous Names
  • rab18a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000027862 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027862|OTTDARG00000021792|ZDB-GENE-030131-3980 rab18a|OTTDARP00000022805 DKEY-208M10.1-001 LG_ BX465854.7 Danio rerio protein_coding KNOWN, 2335 bp
GAAGAAGAGAGAAACGTTTAGCCCTCGGATGATTTTTTCT
CCTTTCTATTTGATTTGTATTTACACCGTCAGTGTTTTTG
CTCATAGAGGCATTTTCCGGTGAAAATGAATGATGATATA
TTGACCACTCTGAAAATACTGATCATTGGCGAAAGTGGAG
TAGGCAAATCCAGTCTTCTTTTGAGATTTACTGATGATAC
ATTTGATGCAGAAATTGGTGCAACAATAGGTGTGGATTTC
AAGGTGAAAACGCTGGCTGTAGATGGAAACCGAGCAAAAC
TAGCAATCTGGGATACAGCAGGTCAAGAACGTTTTCGGAC
TTTAACACCCAGTTACTACAGAGGAGCTCAGGGTGTCATT
CTGGTGTATGATGTCTCTAGGCGAGAGACATTTGCTAAGC
TGGATAATTGGTTGAGTGAGCTGGAGACGTACTGTACAAG
AAATGATCTTGTCAAGATGCTAGTGGGAAACAAAATCGAT
AAGGATGATCGTGAGATTGAGCGAGAGGAGGGCCTGAAGT
TCGCAAGAAAACACTCCATGCTTTTCATAGAGTCCAGTGC
TAAAACAAGGGATGGTGTCCAGTGTGCCTTTGAGGAGCTG
GTGGAGAAAATCCTGCAGACTCCAGGCTTGTGGGAGAGTA
TGCATAAGTCAAGAGGAGTTGCCCTGTCTGAACTCTCTGA
AAGTAGTCAAGGAGGCTGCGGGGCGTACTGCTCACTTCTC
TAACACGCACACTGGTGTTTAGACAGTGCAGGTTAGATTA
GTTAACCCATACAAAGGATACATATGCCTTTTTGGTAAGT
GTATCCCCGCGAGCACACAAACAAAACTTTCATAAGTATT
AATCATTTAACAGAGCTGACAAAAACAAAGAAGATGGCTG
GAAATAGATAAGCTTTTCTTGTGTTAAAATTCATTTGACG
ATTTTTATCGAAGGCATGCTGATCATTTGTATTCAGGAGG
GGGATAAAAAAAAAAAAAAAAACTTGATTACTCCATAATA
CCTCAGATCAGTTTGCTTCTCGGTTTGTATATTGCTCGTA
ATGTTTTACTTTGTTTTGTCCCAGTGCCTGTGTTTCTTAT
TTAGGAAGAGGTAAACACTCATCAGTCTAACTCGACCTTT
CAAACTGCTGGAATGAGCTCTCAGTAGAACACAGATTTCC
ATCAACATGCCCTCTCTTGATGTCTGCAACGTGCGGAACT
CCGTTCTTTCTTTATCTGTCCATCTTTGGATCCCATTTTT
TCCCTACTGTCAGTCACTTGTTAACTTTAGTTCCTCCCTC
TCTCTCACTACATGTATCTGTCTTCAATTCACTTCCACCA
TTCCCTCTGTTTCTCCACTGAATAATAGAGTTAGCAAGCG
TTTGGATCTGTGTTTTACTGCTTTTATTGACTTGGGCCGC
CCACTTCAAAACATGTTTTTGAAGGGTTTATAAATCAAAC
ATATTGGCGCAATGAATCTCTCTTTTGTACATATAAACAG
AGGGTAAAACTGGCTAAAAATAAAACTTGCCTTCAGACTT
ATGGACAGTGTAACATGTCTGTCCATCATAGAGAAGAAAA
AAAAAAGATCCTCACAGTGTGACTATAGATGGTTTTTACG
CACAGAGAAATGGAACAAAAGAACACATTTAGAAATAATA
AATGTTCATCCCAAAAATGCACGGCACTTAATGGCGATGC
CAAATGAATATTTCCATTCTCCCGGTTTAATCTGGACTAT
TTGATCTGGACTATTTAGTCTGTTCTGTTTGCTTTAGAGA
AACATCCAGGGGGTCCCAGATGTCGAGTCTTGTATTCATT
GCTTAAAAACTGGGTGGTAAAGTCCTTTCGAGAGCCAACT
TCAGTTATAGCAGTTTTAGAAAGTGTGTGGCACATGTGGA
AGGAAACGCAGGGTTTGAATGCACACCCACAGAAAAGTCC
TCATTTTTGCATTCCTTTTTACTTGTTTTGATATTTGCTG
ATAATTAGAAGCTGATTTATGTATTGGGTGGTTTCAAGTT
GCATGCAATATGTCTTATGTGCATTTTTAGGGCAGTTATA
TAGTATCTAATTGTATATTTTTTTCACTATTCATCATCAT
ATAATTCTATATGAGAGTTAATTGCCATTGATTGAAGGAC
TTTTGGTTTAGGTTCTTCACTGTTTTATGGATATTTATGT
CCAAACCTTATGAGTATAATACACAAGAATGAGTTTACGC
AATATTGCCTACTGTTATTGCACATTAATTACTCTATGTA
AATATTTGCTTATGATGGTCATAAATATATTGTAATGTTG
ATGTGTGAGTCTCTGCACTATAATGAAATGACAATATTTT
GTCTTTGAATACCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations