Transcript

strada-201

ID
ZDB-TSCRIPT-090929-10398
Name
strada-201
Previous Names
  • strada-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027858 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027858|OTTDARG00000021788|ZDB-GENE-030131-6482 strada|OTTDARP00000022802 strada-002 LG_ BX324157.4 Danio rerio protein_coding KNOWN, 2305 bp
CCGACCGTTCCTCAACACGACCCAGCCCACGGCGAGGAGA
AAAAATACGTTACATCCACAGCTTTGTTGATAGTCGAAAA
TTTGACGATTTTCATTAGTAAAAGCTACATAAGTTATTCG
CGGAGGATTTTTACTCTTTGTGGGTTTATGAAAGTGTTAT
TACCTGTCATCATCACCATCTCAGGATCCATGTCTTTTTT
GCGTTGGGTGTCAGAGAAACTCAGTGTGGAAAGCCTGAGG
GATCTGGAGTTATTTGGAGGCCCATGAGGACAGTCGGGAG
TCTCTGAACCCCCTCCCTCACAGGGACACCATGGGAAGCT
TTCTTCCAGACAGCAGTGCCTATGAGCTGCGCAATGTCAT
AGGTAGAGGTCTGGAGTCCTTGATGACAGTCAATCTTGCC
GTGTACAAACCCACAGGAGAGTATGTAGCCATCCGGCGCA
TTGACCTCGATTCATGTGCCAATGACATGGTCAGTTACTT
ACAGGGAGAGCTCCGTGTGTCTAAGCTGTTCCACCACCCC
TGTATCCTCCCGTACAAGAGTGTCTTCATAGCTGAGAATG
AACTGTGGGTCATCACACCCTTCATGGCCTATGGATCAGC
ACGAGATTTGATCATTACACACTTTACTGATGGCTTAAAT
GAGCAGACGATTGCATACATTCTGCTGGGTGTGCTGAGAG
CTCTGGAGTACATTCATCAGATGGGCTACGTTCACCGCAG
TGTGAAGGCAAGCCACATCCTGATTTCAGCAGATGGACAG
ATGTTTCTGTCTGGTCTTAGGAGTATCTTCAGCTTGATCC
GTCATGGTCAGAGAGCTCGTGTTGTGCATGATTTCCCTCA
GTACAGTGTTAAAGTTCTGCCGTGGCTCAGCCCTGAGGTT
CTGCAGCAGAATCTTCAGGGATATGACTTCCGCTCAGACA
TTTACAGTTTGGGTATCACTGCATGTGAGTTAGCTAATGG
ACATGTGCCCTTTAAAGACATGCCTGCTACACAGATGTTG
TTAGAGAAGCTGAACGGTACAGTCCCCTGCCTGCTGGACA
CCACCACCATCCCGCCTGAAGAGCTGAGCATGAAGCCGTC
TCGCTCGGGGGCTGACTCTGGGATCTGCGAGGGCCCCGGC
GCTGGTGGAGCTCGACACACAAACGGGGAGCCCTCGTCCT
CCTCTGGGGGAAACCCGTACAGCCGTACATTCAGTTCTCA
CTTTCATGCCTTTGTGGAACTGTGTCTACAGAGAGATCCT
GAGAAAAGACCCTCTGCCAGCTCTCTAATAGGCCATTCCT
TCTTTAAACAGATCAAGCGGAGACCATCTGAAGCTCTTCC
TGAGCTCCTACGTCCAGTTTCTCCAATCAGCAGCCTCGAC
AGCATGCAGCATCAGGATTCACCCACCGGACTGGCCAGTC
TGGAGTCGGATCTCAGCCAGCTGGATGTGGACGACTGGGA
CTTTTGACACTGGGTGGATGAGGCATGAGGAGGTCGATGA
ATTGGAGGGAAAAGGTGATTTTTTTTGTTTTGTTTTGTTT
TTAAGTTGTGTAAGACTCTTAATGAAAAATGGGGGAAATG
TTTTTGTTTGCTTTTTTCATTTTAAAGGAAGAAAAAGGGA
AGGCCTGTATTATGTATGAGTGTGATATTGACATTGCAAA
GAGCTTCAAAGAAGCTTATAAGACACTCCAGAATGCTTTC
TTATTGTCCTTTGTGATTTGTGTACGTCACTAAAAGTACA
AGGAAAACATAAAAGGAGAAATGAAAAGCCAGCAGCCACC
ACAGCCTTGCTAATGCATCGAGAAGCATGAACTGAAGCCC
GAGGCAATGCACCGCACACCCCTCAAACATTTCGGTTACT
CTTACAGACTGGCCATGTGATGAATGGCGATCGTTTGAGG
CTACCGACATGTGTTCTGTCCATTTCAACTCAACTAATGA
CACTCTATGAATGTCTGCCAGGTCACAGCAACCGTTTTAC
AGTTCAGTTCTCATGTCTCCATGTAGACCTGTCCAACTAA
GCGTAAAGAGCTCTTAGTAAGAGTCAACATAAACACAGCA
GCGTCCAGTTAATGGACGGATTGTGGGAGAGTTTCTTCAT
CCCCCTTGCATGAAAGGAAATATGCTGGAAGAGAACATTT
AAATTTTGGCCTGCTTTCTTGGACAATTATTGGTTTAAAA
TATTACTTCTGTTGTATTGTTTGCTGAGATTAAGGTGTCT
TTGGCATGTGTTACAGAAGGAAGTACTTCAATGGACCGTC
TGTGTATTTTCAGTATATTTACCTCCTGGTCAAATGGAAT
AAATGTTGCATCCGCACAAATGTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations