ZFIN ID: ZDB-TSCRIPT-090929-10374
Transcript Name: asb5b-201
Previous Names: asb5-001, asb5b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027832 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027832|OTTDARG00000021770|ZDB-GENE-050417-271 asb5b|OTTDARP00000022780 asb5-001 LG_none BX649481.10,CU915613.6 Danio rerio protein_coding KNOWN, 1546 bp
AACACATCCCTGAATCTCATTCCAAAACATTCACAGTCAC
TGAGCAGCAGCAATGACTGAGATTTTAGAGGAGCGGCCTT
TCGGCTCTAATACCAACGTCTACTTATCAATTTTCGTACT
TTTTTGCTTTAAACTTTTCGTCAAGATTAGCTTGAACATA
CTTACTCACTTCTACGTGGTTAAAGGAAATCGTAAGGAAG
CAGCACGGATCGCAGCTGAGTTCTATGATTTTGGCCAAGG
GCACAGATCTTGGGCAGATCGTTCTCCACTCCATGAAGCT
GCATGTCAAGGTCGACTTCTGGCACTTAAGACTCTTCTAT
CACAGGGTTACAGTGCAAATATTGTCACCATTGATCATGT
GACTCCACTACATGAAGCTTGTCTGGGAGATCATGTAGCC
TGTGCCAGGGCACTCATAGAGGCTGGTGCCAATGTAAATG
CCACGACCATTGATGGTGTGACACCGCTGTTTAATGCCTG
CTCAGCAGGAAGTGTCACCTGCGCAGAAGTACTGTTGGAG
CATGGAGCAAAACCACAGGGGGAAGTGTGCCAACCTTCGC
CAATTCATGAGGCATCTAGCAAAGGCAGGGCGGCATGTAT
AGATTCTCTCATCTCATGGGGAGCAGATGTAGATTTCGAC
ATCCCTCATCTAGGAACACCTCTCTACATCGCCTGTGCTT
CCCAGCAGCTCCAGTGTGCACAGAAACTTCTGGATGGAGG
AGCCAATGTGCAGAAGGGACATTTTCTGGACACTCCACTT
CATGCAGCAGCACAAAAAGACAGTCCAGAAATCATCAAGG
TGCTACTGGAGTTTGGTGCTAGCATTAATGCTCGCAACCT
AGAGTTACAAAAGCCAGTGGAAACAGCGCCACCCAGCAGT
ACGGCAGAGGCTGTACTACTTCTTTATGAGGCCACGCCGC
AGTCTCTATGTCAGCTGTGTAGACTGAGTATCCGAAACTA
CATGGGCCGATCCAGACTGCACTTGATTCCTCACCTCAAA
CTGCCTACTCTGCTCAAGAGCTTCCTTCAATACAGATAAC
CTCTCCACCTCCCTCATAAAGCCCCATCCACACTTTTATT
TTCTTATTTTAAGTGCATTAATATACACAAAGGTCACCTG
TTCTTGTTTGTGACCACCAACGCACAGACAACACCATCAC
GGCTGCAATTCATTCATTAAAAGAATCTAATATATTTTGT
GCGCAACTAATGTACATCAGTTATATTTTGTAAGAATCTT
CATTTACAAATTTATTGTAAATTAGTCACTTGTGACATGT
CCATCCTTATGTTTGTATCAATATAAATTGCATGCCTAAC
GTGATGCAAATTTATCATGTCAGAAATTACTGAAGTCAAA
GAAAATATAGTGAATTTGCTATTTTTTACCAAGCTAACGC
TTTCAGTTTTTCCACATTTTCAAAAGCTGCAATCTGAACT
GTTTTAAAAGGGGACAATTCAATCTAATGTAGTACTTTTG
CTAAACATTTTGTTGCCAAACAAAGCATGATAAACTTACA
CACAAATAAAGATATGCATACTTTGA

asb5b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA asb5b-201 1546
asb5b-202 (1)    Ensembl 206
asb5b-203 (1)    Ensembl 743
asb5b-204 (1)    Ensembl 744
asb5b-205 (1)    Ensembl 853
ncRNA asb5b-006 (1) 432
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asb5b-201 Contained in:
[BAC] CH211-103D13 (1)
[Fosmid] CH1073-391H9 (1)

Genome Resources: Vega_Trans:OTTDART00000027832 (1),  Ensembl_Trans:ENSDART00000075230 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC093197 (1) 1545 nt
GenBank:CN023325 (1) 865 nt
GenBank:CN324384 (1) 860 nt
GenBank:CN015002 (1) 829 nt
GenBank:EB945417 (1) 542 nt
CITATIONS (2)