header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1155
Transcript Name: asb5b-203
Previous Names: asb5-004, asb5b-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048410 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048410|OTTDARG00000021770|ZDB-GENE-050417-271 asb5b|OTTDARP00000037977 asb5-004 LG_none BX649481.10,CU915613.6 Danio rerio protein_coding KNOWN, 743 bp
AAAAAGAAAGCGAGAGGACGTCGACGAGTTTTCTGCGAAA
AAGAAATCGCGCTGGGGTGTTTTGATTAGTCAAGGATATG
GCGTATGTGTATGAATGGCTTGATGTGCCGTGGGGCGATG
GAGATTTGGGATCTTGGGCAGATCGTTCTCCACTCCATGA
AGCTGCATGTCAAGGTCGACTTCTGGCACTTAAGACTCTT
CTATCACAGGGTTACAGTGCAAATATTGTCACCATTGATC
ATGTGACTCCACTACATGAAGCTTGTCTGGGAGATCATGT
AGCCTGTGCCAGGGCACTCATAGAGGCTGGTGCCAATGTA
AATGCCACGACCATTGATGGTGTGACACCGCTGTTTAATG
CCTGCTCAGCAGGAAGTGTCACCTGCGCAGAAGTACTGTT
GGAGCATGGAGCAAAACCACAGGGGGAAGTGTGCCAACCT
TCGCCAATTCATGAGGCATCTAGCAAAGGCAGGGCGGCAT
GTATAGATTCTCTCATCTCATGGGGAGCAGATGTAGATTT
CGACATCCCTCATCTAGGAACACCTCTCTACATCGCCTGT
GCTTCCCAGCAGCTCCAGTGTGCACAGAAACTTCTGGATG
GAGGAGCCAATGTGCAGAAGGGACATTTTCTGGACACTCC
ACTTCATGCAGCAGCACAAAAAGACAGTCCAGAAATCATC
AAGGTGCTACTGGAGTTTGGTGCTAGCATTAATGCTCGCA
ACCTAGAGTTACAAAAGCCAGTG

asb5b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA asb5b-006 (1) 432
mRNA asb5b-201 (1) 1546
asb5b-202 (1) 206
asb5b-203 743
asb5b-204 (1) 744
asb5b-205 (1) 853
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asb5b-203 Contained in:
[Fosmid] CH1073-391H9 (1) (order this)
OTHER asb5b-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048410 (1)
  • Ensembl_Trans:ENSDART00000148790 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN324627 (1) 816bp
    CITATIONS (2)