Transcript

ch25h-201

ID
ZDB-TSCRIPT-090929-10364
Name
ch25h-201
Previous Names
  • ch25h-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027821 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027821|OTTDARG00000021765|ZDB-GENE-041212-81 ch25h|OTTDARP00000022771 DKEY-26G8.1-001 LG_ BX000534.11 Danio rerio protein_coding KNOWN, 1121 bp
ATCATTCAGATTTAGAACTGAAAAGAAATAGAAATGTTTG
GACTACAGCACATCTGGGACTGCATTCTGCAGTACGAAGC
ACAGCTAAGGTCTCCATTTTTCCCAGTCCTCTTCTCAATT
ACAGTCTACCTAAGCTTCTGCCTGCCTTTTGTCCTTCTGG
ATGCCCTGTCTCCAAAGGTAGAACTGATAAGGAGATACAA
GATCCAACAGAAAGCCAGCGTGTCTTGGACTATGATGTGG
AGCTGCCTCGCACTCTCCCTCTACAACCACGTGGTGTACA
TCTTCCCGCTGAGTGTCCTGCACTGGTACTGGAGACCTGT
CAGCTACCTAGCGGAGGCACCTGGGGTCTTGCGGGTCGTC
TGGGATCTTGCTGCCTGCCTGCTTCTGTTTGACTTCCAGT
ACTTTGTGTGGCATCTTCTACATCACAAAGTGCCTTGGCT
TTACCGGACTTTCCATAAGGTGCACCACAAATACACATCC
ACCTTCGCTCTGGCCACTGAGTACTCTGGGGCTTGGGAGA
CCCTGTCTTTGGGGTTCTTCGCTGCGGTGAATCCCATGTT
GCTTGGGGTTCATCCTATGACAGAGATGCTCTTCCACATG
CTGAACATGTGGCTGTCAGTTGAGGACCATTGTGGCTATG
ACCTGCCATGGGCCACGCACAGACTGATGCCTTTTGGACT
TTACGGAGGAGCTCCACACCATGATGTCCACCATCAGAAG
TTCAAGTCCAACTACGCTCCATACTTCACTCACTGGGACA
AGCTCTTTGGGACACTGCACTTTGAATGAACAGAACATTT
GAAACAGACTCTTTTTTTTGTAAAAAGTTCTTTCTCATTC
TGTGAATGAATACCTTTGACTCTAAAACTTTATAAAAGAT
TATTTATAATTCAGATCTGTTTGACCAATTTGTCTATTTA
TTGAGTGTCTGTATTTAAGAGTGACTGTAAAAACTGAGAT
GTAAGAAATGTATTATGTTAATCATATTATATTTATTATT
TATAAGATTGTTGTTTTGCATTTATAAGTTTGTGTTGTTG
TTATTACTAAATGTATTAACGTGGACCATGAAGAAATTCA
ACAAGCTAATTGCAATAAATCTGTGAAGTAGATAATATAA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations