Transcript

ugdh-201

ID
ZDB-TSCRIPT-090929-10221
Name
ugdh-201
Previous Names
  • ugdh-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027674 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027674|OTTDARG00000021686|ZDB-GENE-011022-1 ugdh|OTTDARP00000022666 ugdh-001 LG_ CR759875.6 Danio rerio protein_coding KNOWN, 2589 bp
AGCTGCTGCTGAAACGCTGTTGTTCACACGTAGCGTTTCG
CCGTCTTTGCCATCACGTCAAATTTAAAGCACCGATATTC
ATTTCGCCCTATAGATAATGCGAGTGTTGCTGAATTGAAT
TTAAACTGTAAAAACGCGTTTTGGTAAAAAAGGCTTATTA
GATTTGCTTACGCCATTGTCAGAATAAGATTTGTTTTGCG
CTGGCTTAGTTAGCGAAGCTCTTAGTTTGAAGAGACTGCA
TGTACCCGGAAGTAGATGTGTACTCTCCCCTCTCTGAAGT
GTTTACGTTGCTATCTCCTCCCGGTGGGGGTGTGTATGTG
TATTAGTGTGTCTGTCTGTATGTACTGCCAGAGTTCATGT
ATCAATAGTTTATTCATTCAAGAACAAGGCGCCTCAGACG
AAGGAATCTTACCTGCATACAACGCTGAGTTTCATGAAGT
ATATCTGTAACTAAAGAGCTGCTCTGTAAGACACGATGTT
TCAGATTAAAAAGATTTGCTGTATAGGCGCTGGGTATGTT
GGTGGTCCAACTTGTAGTGTCATTGCCAGCATGTGTCCTG
AGATCACGGTAACAGTGGTGGATGTTAATGAATCCCGGAT
CAAAGCCTGGAACTCTGATACACTACCCATTTATGAGCCG
GGCCTGAATGAAGTGGTGTTGTCTTGTCGCGGGAAGAACC
TCTTCTTCTCCACAGATATAGACTCTGCCATTAAAGAAGC
TGATTTGGTCTTCATTTCAGTAAACACCCCAACTAAGACG
TACGGTATGGGCAAAGGGCGCGCTGCTGATCTGAAGTTTA
TTGAGGCATGTGCCCGGCGGATTGTAGAGGTGTCAGACGG
GTATAAAATCGTTACAGAGAAGAGCACAGTGCCAGTTCGT
GCAGCTGAGAGCATACGCAGGATATTTGATGCCAATACCA
AACCCAGCCTTAATCTACAGGTTCTCTCTAACCCAGAGTT
CCTTGCAGAGGGTACGGCAGTAAAGGACCTTAAAGAGCCA
GACCGCGTCTTGATTGGTGGAGATGAGACTCCGGAGGGTC
AAAGGGCTATCAGTGCTCTCTGTGCAGTTTATGAGCACTG
GGTCCCTAAAACACGCATCATCACCACCAACACCTGGTCC
TCTGAACTTTCTAAACTGGCAGCAAATGCGTTCCTGGCTC
AGCGCATCAGCAGTATAAACTCCATCTCTGCGCTGTGTGA
ATCCACTGGTGCTGATGTGGAGGAGGTGGCCAGAGCCATT
GGCATGGACCAGCGAATTGGCAGCAAGTTCCTCAAAGCCA
GCGTCGGATTTGGAGGAAGTTGTTTTCAGAAGGATGTGCT
GAATTTGGTTTACCTCTGTGAAGCACTGAATCTACCAGAG
GTTGCTTCATACTGGCAGCAGGTGATTGACATGAATGAAT
ATCAGAGAAAGAGATTCGCCTGTCGGATCATTGACTGCCT
GTTTAACACGGTTACAGGGAAGAAAATCGCCTTGTTGGGT
TTCTCCTTCAAGAAAGACACGGGAGACACCAGAGAGTCGT
CCAGTATTTACATTTCAAAGTATTTGATGGACGAAGGAGC
CAAGCTGCATATTTATGACCCTAAAGTACTGAAAGAGCAG
ATAATCCAGGACCTGTCTCAACCCGGCATCTCCGGAGACA
ATCCAGAAAGAGTGTCTGATCTTGTAACAGTGACGGTTGA
CCCCTATGAGGCCTGTGAAAGTGCACATGCTCTGGTCATC
TGTACAGAGTGGGATATGTTTAAGGACCTGGATTATGAGA
AAATATATCACAAGATGTTGAAACCAGCGTTCATTTTTGA
TGGACGACGAGTCCTGGATCATCTGCATACCCAACTACAA
AACGTTGGCTTTCAGATCGAGACCATCGGTAAGAAGGTGA
TGACACGAATCCCCTTCACAACCTCTGGAGGAGTACCACG
AATCACTGAACCACCAGTAAAGAAATCCAAAGCCTGAGGC
ACAGCTCATCGTCCACACCACACACACGCAGGCACTTTAC
GCTAATCAAAGTCTTTCTCTGAGAAAACCAAAGTAATGTG
TGACCATTGCTGGAAATCAACAGACTCTTCTGTTAGTAAA
AGTGCACATGCTCTGTGTTTGTGTGTGTGTGTTGAACTGT
GTTTTTTAATCAGAGTTTTATCTTTTATGACCGTTAGCAA
AAACTTTTATCATTGATGATTCCTATAATATCTTGAATGT
TCTCATGTCTGTACCATTTCAGATAAACTGTGCACAAAAC
TGGTGTTAATGCATTTCAACATCCCACTACTGTTCAGTAG
TGTATTAATGTTTACAGCTGTCAGTGTTTTGGTTTTTAAT
ACCAAAATCATATTAGGAATGACAACGTTTAGGACCAAGT
GGGACATTAAAAACTCTATCAAACATTTGGGTTCAATTTG
GCACGTGATACCTCTAGCAAATATCTGTTCATTTCACCCA
GTTATTAATCTTCTGATATATATATGTATTGTATGTTATT
ATAGTTGTAGGTTTTATAAAATCATCTCTTACTGTACAGG
TTTATATTGATCATGTACAATGATTGCAAAAATCCGATTT
TTAAAAAAATAAAAATGTATCAATGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations