Transcript

slc25a4-201

ID
ZDB-TSCRIPT-090929-10159
Name
slc25a4-201
Previous Names
  • slc25a4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027611 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027611|OTTDARG00000021642|ZDB-GENE-030131-5275 slc25a4|OTTDARP00000022612 slc25a4-001 LG_ CR759951.21 Danio rerio protein_coding KNOWN, 1434 bp
CATTTGAAGGGTCGTCGCAGGGATTCATATAGGGTCCTAA
GGTGGTGAGATTGTCTTCCAGGAGATAGGACATCATGTCT
GACGCAGCGATCAGCTTCTTGAAGGATTTCTTGGCCGGTG
GTGTGGCCGCTGCCATTTCCAAGACAGCAGTTGCCCCCAT
TGAGAGAGTCAAGCTGTTACTGCAGGTCCAACATGCCAGC
AAACAGATCACGGCCGATATGCAGTACAAAGGCATCATTG
ACTGCGTAGTAAGAATTCCCAAAGAGCAGGGATTCCTGTC
GTTCTGGAGAGGCAATCTTGCCAACGTCATCAGATACTTC
CCAACACAAGCCCTCAACTTTGCCTTCAAAGACAAGTACA
AGAAGATCTTCCTCGGAGGAGTGGACAAGAATACCCAGTT
CTGGCGTTACTTTGCCGGTAATCTGGCCTCTGGCGGTGCT
GCAGGTGCGACCTCTCTGTGCTTCGTCTACCCTCTTGACT
TCGCCAGAACAAGACTTGCTGCTGATATCGGCAAAGGTGC
AGCCGAGAGAGAGTTCACCGGTCTCGGAAACTGTGTTGCC
AAGATCTTCAAGTCTGATGGTCTTAGGGGTCTCTACCTTG
GCTTCAATGTGTCAGTCCAGGGCATTATCATCTACAGAGC
TGCTTACTTCGGTATCTATGATACAGCTAAAGGTATGTTG
CCGGATCCCAAGCACACACACATTGTTGTCAGTTGGATGA
TCGCCCAGACTGTCACAGCCGTTGCTGGTATCATTTCATA
TCCCTTCGACACTGTCAGGCGTCGTATGATGATGCAGTCC
GGACGCAAAGGAGCTGACATTATGTACAAGGGCACAATCG
ACTGTTGGAAAAAGATCGCCAAAGATGAGGGTGGTAAAGC
TTTCTTTAAGGGCGCCTTGTCCAATGTGATCAGAGGTGCG
GGAGGCGCTTTTGTGCTGGTCCTGTATGATGAGATCAAGA
AGTACACATAAACATTCTCCATCCATCATGTCCATCCCCA
CCAAAGGAAACCCTGAGCGCTGTGTATGTCTTAATTGTGT
AGAATGTTTAACAACCAAGGGAAGTGTACTTAGCCAAGCT
GGCCCAGGGGTGGATGGTGATCATGTGATCGTGGGTGGTC
ACTGCATCCTCCACCCCAACACTTGTAAATATATTGAAGT
TTACCTGCTACTGCCCTTCAATTTAAGTCGACTTTCGGTC
TGGTTAGATTGAAAGTCATGGTTTATTTTTTTCTCATTTA
TTTATTTGAATTTCAATTGATTTCCTCATAAATCTTGAGG
GTCTACATGTTCTACAGTGGCTCTTCTCTTCTAGTTAGCT
GAAAACATTTTGTCCCAGACTGAAGCAAGTGACCGTACAC
TGGAAAGCTGAATGTTTTTGTGGTGTATTCCACTTCATGT
GTTCTTTTAATAACAATAAAGCTGAAAATACACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations