ZFIN ID: ZDB-TSCRIPT-090929-10046
Transcript Name: paxip1-202
Previous Name: paxip1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027492 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027492|OTTDARG00000021576|ZDB-GENE-041010-214 paxip1|OTTDARP00000022520 CH211-207D6.1-001 LG_ CR855328.8 Danio rerio protein_coding KNOWN, 3757 bp
GGCGCTTCTCTACCCTTTTCCTATGAGGCCGGTTGTACGC
TAATCTGTCAGTCTCATAATGCTTACTTTCCGTTTTAAAA
TTATTTAAAGAAGTCAAAACAATGTCGGAAGACGATTTAA
AAGTACCGGAAGAGCTTTTCAAGGACGTGAAGTTCTATGT
GGTGGGAGACATTGACCAGAAGGTTGTACAGCTCTTGAAA
TCTGGGAAAGGAAAAGAAGTATCTTACAATGCCCTCGCCA
CCCACATTATAGCAGAGGATGGGGACAATCCAGAGGTCGG
GGAGTCCAGAGAAGTCTTTGACTTGCCTGTTGTCAAGCCG
AGCTGGGTGATCCTCTCTGTCAAATGTGGCGATTTGCTCC
CAGTTACAGGATTTTCTCCAGAATCTGGGCAAGTGTTCTT
TGGCGTTACAGCTTGTCTGCCACATCTGGCAGAGGATCTT
AACGCACTTTGGGCCTTTATTACATTCTATGGAGGTGACT
GTCAGCTCCATTTCAACAAAAAGTGTACGCATCTGGTTGT
GCCTGAACCAAAGGGGGCCAAGTACGAGTGTGCTTTGCGG
CATAATAACATAAAGATAGTAACTCCAGAATGGATTTTGG
ACTCTGTAAAAGAAAAGAACAGGAAAGATGAGATGCTATA
TCACCCACGACTCACATTATATGATGCACCGGAAGAGGAG
GGCAGTGAGTATGAAAACGAGAGGAGCTCACGATCTGAAG
GTAGCTATAGTGACAGACGCTCGCCTCACAGCCGACGCTC
CAGCCCTACATCATCCCGAGACGCATCCCCAGCAGGCAGG
CGCTCACCCTCAACCAAACATGAACGCAAATCAGAGTTGA
TGTTCGATGACTCTGATGACTCATCCCCAGAGAAGGAGGA
TCGCAATCTCAATTGGACCCCAGCTGAGGTGCTTCCGCCT
GGTCCGGCTAAACGTCGACTACAGCCTGGCAAAGAAACCG
GTTTGATCAATCTGTGTGCCAATGTCCCACCTGTACCAGG
AAGCTTTGGGCCACCTGATGCACGAATGGTCGGTGCAGGT
GCAGGTGGAGGTGTGCCTATGGGGGTGGAAAGATTAGAGG
TCATGAGTGAATGGAATTCAGCCGCCAGGACGCTAAGAAA
CATCACTAACAACACTGATACCCAACAGCCCTCTCGACCC
TCCAATGTGGCACATATCATCCAGAGTTTTTCCGCATCCT
CTAAAGGTGTAGTGGATCATATGGGAAATCAGGGCCAGTC
TGGTATTCCCAACCAGCTTCTGTTAAAAGCCCAACAGCAG
CTTCCTCCTGAAGCACAGCAGCAGTTACTGCAACAACAGC
AGCAGCAACAGTCACATCAGCTACAACAGCAACAGCAGCA
GCATCAGATGGCACAACAACATCCCATGATGCTGCCACAG
GTCATGCAGATGCACCACCATCAACAACAACAACAGCATC
AGCCGCCGCCACAGCAACAACAGCAGCAGCAAAACCAACA
AGGCTTTCCTCAAATGCCTCCACAATCGCATCAGTTCTTA
CAGCAACAGATGCATCAGCAGATGTATTCCCAACATCAAC
AGCAGCAGCAGCAGCAGCAACAACAGCAGCAGCAACAACA
TGCATTCCCACAACAAATGCGACCCCAACAGCTTCCGAGG
CTGCCCTTGCAGCATCAGCAGCAACATGTGCTGCAACAAC
AGTTACAGTTACAGCAGCAGCACAGACTTCAGTTGCAGTT
GCAACAACAACAACAACAGCAGCAGCAACAACAACAACAG
CAGCAGCAGCAGCAGCAGCAACAACAACAACAAAAACAAC
AACAGCAGCAGCAGCAAAACCAGCAGCAGATGCACCAACA
GCATTTGCAGCAGCAACAGCATTTCCTACAACAACAACTC
CAACAGCAGCACATGCAACAGCTGCAACAACAGCAGCAAA
TGCAGCAGCAACAGCAACAACATCTGCAGAACCAGCAGCC
TCTGCAACATCAGAACCAGCAGGTTAATCCACATCAGACA
CAGACTATGCTTCAACCTCCAATCACATCTGCACAGCTCT
TTGGACACGAGCCTGGCCATGACATACCTGAAGAGGGATT
CCTGGTTGGCTGTATTTTTGCCATTGCTGACTATCCAGAA
CAAATGGCTGATAAACAGTTACTGGCCACATGGAAAAGGA
TAATTCAGCTAAATGGAGGGACTGTAGACTCTGCTCTCAA
CCGCTGCACTCATTTACTTTGTGAGAGTCAAGTCAGCAAC
ACCTATCTCCAGGCGCTGAGGGAGGGAAAGCGTTGTGTGA
CGGCTCACTGGCTCAACACTGTCCTCAAGAAGAAGAAGAT
GGTCCCCCCTCACAGGACCCTTCATCTTCCCTTCAGCTTT
CCTCCAGGGGCCAAACCGTGTGCACAGCATATTATTTCTG
TGACTGGATTTGTGGACAGTGACCGTGATGATTTGAAGCT
CATGGCGTATCTAGCAGGAGCACGATACACAGGCTATCTG
TGTCGAAGCAACACTGTCCTTATCTGTAAAGAACCAAGCG
GGCTGAAATACGAGAAGGCGAAGGAGTGGAGGATCCCATG
TGTGAATGCACAGTGGCTGTGTGACATCCTACTAGGAAAC
TTCGAAGCTCTCCGGCAAATCCAGCACAGCAAATACACTC
AGTTTAATTTGCCTGACCCGCTGGCACCAAATCATCATCT
TGTGCACAACCTTCTGAGTGCTTGGCGTATTCCTGTGAAG
ATCTCACCGGAGGCATTGGCGAGTTTACGTCTTCAGCTAA
AACAGAAACAGGCTGACGTCAGTGTGCAGCCGCCCAGCAA
GAGACCCAAGCTAGAAGAGTTGCCAACACCCACTAAAAAG
CTTCCACCTGATTCAACACCTTACGTCCTTTTCACAGGCT
TTGAACCTCTGCAGGCTCAGCAGTACATAAAGAAATTGTA
TGATCTTGGAGGGGAAGTGGCTGACAGCACTCAGAAGTGC
ACTCATCTGGTTGCTAACAAAGTGACAAGAACGGTGAAGT
TCCTCACTGCCATATCCGTAGTCAAGCACATAGTCACTCC
AGAATGGCTGGAGGAAAGCTGGAAAAGCCAGAAATTTGTG
GATGAGCAAAGCTACATGCTGCGAGATGCAGAGGCTGAGG
TGCTGTTCTCTTTTAGCCTGGAGGAGTCACTGAAGAGAGC
TCATGCAGCTCCGCTCTTTAAGGGGAAGTATTTCTATATA
ACTCCAGGAATCTGTCCCAGCCTCAGCACAATGAAGCTTA
TAGTGGAGAGTGCCGCAGGGAAAGTGCTCTCCAAACAGCC
CTCCTACCGCAAGATCATGGAGCACAAGCAAAACAAGAAT
TTACCGGAAATCATACTAATAACCTGTGAAAATGACTCTC
ATCTGTGCCGAGAGTATTTCCTGAAGAACATCGAAGTGTA
CACTGCTGAGCTTATATTGACAGGGGTGTTGACTCAGTCC
TTGGATTATGAATCGTATAAATTCACATGATGTCCTTGTC
AGGACAGGAATATTTTATGACTGCTGGTGCCCTGTTCTGG
ATCAACGCTAAAGGTTGCTTATATTTTAGTGTACAGTCAT
GTTATCTTTCAATGTTTGTATTTTATTAATTGATTATTAC
ATTTCTTACCAGTTTTGTAAAGAAAGTAACAGTGAGTCTT
AATACATTGCTGTTATTTGTAATGATTGTTTAAATGAAGG
CAAAGCTATGTTTTTACTGTGATTTTAAATGTTTGCCCCT
TTTGGAATAAAATCTGAATTTGATTGCAATTCTTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
paxip1-202 Contained in:
OTHER paxip1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027492 (1)
  • Ensembl_Trans:ENSDART00000144672 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC083530 (1) 3746bp
    GenBank:EB776856 (1) 505bp
    CITATIONS (2)