TALEN

TALEN1-csf3r

ID
ZDB-TALEN-190621-1
Name
TALEN1-csf3r
Previous Names
None
Target
Target Sequence 1
5' - TGTACCAAGGGCGGATGTGT - 3'
Target Sequence 2
5' - TTCAGTTGTCAGGGTCGAAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mdu5 csf3r
mdu6 csf3r
Expression
Gene expression in Wild Types + TALEN1-csf3r
No data available
Phenotype
Phenotype resulting from TALEN1-csf3r
No data available
Phenotype of all Fish created by or utilizing TALEN1-csf3r
Phenotype Fish Conditions Figures
common myeloid progenitor decreased amount, abnormal csf3rmdu5/mdu5 standard conditions Fig. 2 from Basheer et al., 2018
granulocyte decreased amount, abnormal csf3rmdu5/mdu5 chemical treatment by injection: lipopolysaccharide Fig. 5 from Basheer et al., 2018
defense response to bacterium decreased process quality, abnormal csf3rmdu5/mdu5 bacterial treatment by injection: Escherichia coli Fig. 5 from Basheer et al., 2018
leukocyte decreased amount, abnormal csf3rmdu5/mdu5 standard conditions Fig. 2 from Basheer et al., 2018
circulating cell neutrophil decreased amount, abnormal csf3rmdu5/mdu5 standard conditions Fig. 3Fig. 4 from Basheer et al., 2018
anatomical structure csf3r expression decreased amount, abnormal csf3rmdu5/mdu5 standard conditions Fig. 2Fig. 3 from Basheer et al., 2018
kidney neutrophil decreased amount, abnormal csf3rmdu5/mdu5 standard conditions Fig. 4 from Basheer et al., 2018
granulocyte decreased amount, abnormal csf3rmdu5/mdu5 standard conditions Fig. 2Fig. 3Fig. 5 from Basheer et al., 2018
defense response decreased process quality, abnormal csf3rmdu5/mdu5 chemical treatment by injection: lipopolysaccharide Fig. 5 from Basheer et al., 2018
myeloid cell cell migration decreased process quality, abnormal csf3rmdu5/mdu5 standard conditions Fig. 2 from Basheer et al., 2018
granulocyte decreased amount, abnormal csf3rmdu6/mdu6 chemical treatment by injection: lipopolysaccharide Fig. 5 from Basheer et al., 2018
granulocyte decreased amount, abnormal csf3rmdu6/mdu6 standard conditions Fig. 5 from Basheer et al., 2018
defense response decreased process quality, abnormal csf3rmdu6/mdu6 chemical treatment by injection: lipopolysaccharide Fig. 5 from Basheer et al., 2018
kidney myeloid cell decreased amount, abnormal i114Tg ; csf3rmdu5/mdu5 standard conditions Fig. 4 from Basheer et al., 2018
kidney neutrophil decreased amount, abnormal i114Tg ; csf3rmdu5/mdu5 standard conditions Fig. 4 from Basheer et al., 2018
Citations