TALEN

TALEN1-il2rga

ID
ZDB-TALEN-160527-1
Name
TALEN1-il2rga
Previous Names
None
Target
Target Sequence 1
5' - TGGCAGTTTGGTGACGGAAC - 3'
Target Sequence 2
5' - TTCTCATACCATATTCTTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mdu1 il2rga
mdu2 il2rga
mdu3 il2rga
mdu4 il2rga
Expression
Gene expression in Wild Types + TALEN1-il2rga
No data available
Phenotype
Phenotype resulting from TALEN1-il2rga
No data available
Phenotype of all Fish created by or utilizing TALEN1-il2rga
Phenotype Fish Conditions Figures
thymus rag1 expression decreased distribution, abnormal il2rgamdu1/mdu1 standard conditions Figure 1 with image from Sertori et al., 2022
kidney cd79a expression increased amount, abnormal il2rgamdu2/mdu2 standard conditions Figure 2 with image from Sertori et al., 2022
kidney common myeloid progenitor increased amount, abnormal il2rgamdu2/mdu2 standard conditions Figure 2 with image from Sertori et al., 2022
kidney nkl.3 expression decreased amount, abnormal il2rgamdu2/mdu2 standard conditions Figure 2 with image from Sertori et al., 2022
thymus rag1 expression decreased amount, abnormal il2rgamdu2/mdu2 control Fig. 4 with image from Basheer et al., 2022
thymus rag1 expression decreased distribution, abnormal il2rgamdu2/mdu2 standard conditions Figure 1 with image from Sertori et al., 2022
thymus T cell trac expression decreased distribution, abnormal il2rgamdu2/mdu2 standard conditions Figure 1 with image from Sertori et al., 2022
kidney lymphocyte decreased amount, abnormal il2rgamdu2/mdu2 standard conditions Figure 2 with image from Sertori et al., 2022
kidney trac expression decreased amount, abnormal il2rgamdu2/mdu2 standard conditions Figure 2 with image from Sertori et al., 2022
kidney cd4-1 expression decreased amount, abnormal il2rgamdu2/mdu2 standard conditions Figure 2 with image from Sertori et al., 2022
thymus T cell lck expression decreased distribution, abnormal il2rgamdu2/mdu2 standard conditions Figure 1 with image from Sertori et al., 2022
blood neutrophil increased amount, abnormal il2rgamdu2/mdu2 standard conditions Figure 2 with image from Sertori et al., 2022
blood lymphocyte decreased amount, abnormal il2rgamdu2/mdu2 standard conditions Figure 2 with image from Sertori et al., 2022
thymus rag1 expression decreased distribution, abnormal il2rgamdu3/mdu3 standard conditions Figure 1 with image from Sertori et al., 2022
thymus rag1 expression decreased distribution, abnormal il2rgamdu4/mdu4 standard conditions Figure 1 with image from Sertori et al., 2022
thymus T cell trac expression decreased distribution, abnormal il2rgamdu4/mdu4 standard conditions Figure 1 with image from Sertori et al., 2022
thymus T cell lck expression decreased distribution, abnormal il2rgamdu4/mdu4 standard conditions Figure 1 with image from Sertori et al., 2022
thymus rag1 expression decreased amount, abnormal il2rgamdu4/+; il2rgamdu2/+ standard conditions Fig. S2 from Sertori et al., 2016
mature B cell decreased amount, abnormal il2rgamdu4/+; il2rgamdu2/+ standard conditions Fig. 2 from Sertori et al., 2016
T cell absent, abnormal il2rgamdu4/+; il2rgamdu2/+ standard conditions Fig. 2 from Sertori et al., 2016
thymus rag1 expression decreased amount, abnormal il2rgamdu2/mdu2; jak3zf3747/+ control Fig. 4 with image from Basheer et al., 2022
thymus rag1 expression decreased amount, abnormal il2rgamdu2/mdu2; jak3zf3747/zf3747 control Fig. 4 with image from Basheer et al., 2022
Citations