header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TALEN-160314-1
TALEN Name: TALEN1-bves
Target: bves (1)
Source:
Target Sequence 1:
5' - AACATTTACACCAATGCCTT - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - CATCTGAGTTGACCTGAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: There was an extra "T" in the published Target sequence 1. The author was contacted and provided the corrected sequence.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-bves No data available
GENOMIC FEATURES CREATED WITH TALEN1-bves
Genomic Feature Affected Genomic Regions    
icl1 bves    
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-bves No data available
PHENOTYPE
Phenotype resulting from TALEN1-bves
No data available

Phenotype of all Fish created by or utilizing TALEN1-bves
Phenotype Fish Conditions Figures
skeletal muscle cell extracellular matrix absent, abnormal bvesicl1/icl1(AB) standard conditions Fig. 6 from Schindler et al., 2016
trunk musculature cytoplasmic vesicle bves expression increased amount, abnormal bvesicl1/icl1(AB) standard conditions Fig. 7 from Schindler et al., 2016
whole organism edematous, abnormal bvesicl1/icl1(AB) standard conditions Fig. S17 from Schindler et al., 2016
atrioventricular node decreased functionality, abnormal bvesicl1/icl1(AB) standard conditions Fig. 6Fig. S18 from Schindler et al., 2016
skeletal muscle myofibril disorganized, abnormal bvesicl1/icl1(AB) standard conditions Fig. 6 from Schindler et al., 2016
slow muscle cell myofibril morphology, abnormal bvesicl1/icl1(AB) standard conditions Fig. 6 from Schindler et al., 2016
heart contraction decreased rate, abnormal bvesicl1/icl1(AB) standard conditions Fig. 6 from Schindler et al., 2016
trunk musculature plasma membrane popdc2 expression decreased amount, abnormal bvesicl1/icl1(AB) standard conditions Fig. 7 from Schindler et al., 2016
skeletal muscle muscle tendon junction detached from skeletal muscle cell, abnormal bvesicl1/icl1(AB) standard conditions Fig. 6 from Schindler et al., 2016
trunk musculature plasma membrane bves expression decreased amount, abnormal bvesicl1/icl1(AB) standard conditions Fig. 7 from Schindler et al., 2016
heart edematous, abnormal bvesicl1/icl1(AB) standard conditions Fig. S17 from Schindler et al., 2016
heart contraction arrhythmic, abnormal bvesicl1/icl1(AB) standard conditions Fig. 6Fig. S18 from Schindler et al., 2016
post-vent region muscle structure, abnormal bvesicl1/icl1(AB) standard conditions Fig. S17 from Schindler et al., 2016
trunk musculature pathological, abnormal bvesicl1/icl1(AB) standard conditions Fig. 6 from Schindler et al., 2016
OTHER TALEN1-bves TALEN PAGES No links to external sites
CITATIONS (1)