ZFIN ID: ZDB-TALEN-151208-1
TALEN Name: TALEN1-tp53
Target: tp53 (1)
Source:
Target Sequence 1:
5' - AAGGCAGAATCAGTGGAGGT - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - GCTCAATCAGGACAAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-tp53 No data available
GENOMIC FEATURES CREATED WITH TALEN1-tp53
Genomic Feature Affected Genomic Regions    
zju101 tp53    
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-tp53 No data available
PHENOTYPE
Phenotype resulting from TALEN1-tp53
No data available

Phenotype of all Fish created by or utilizing TALEN1-tp53
Genome Resources:
CITATIONS (1)