header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TALEN-151102-1
TALEN Name: TALEN1-zc4h2
Target: zc4h2 (1)
Source:
Target Sequence 1:
5' - TCTTCTGCTGCAAGAGAAAA - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - TGAATGAGCCGCAGCTCCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-zc4h2 No data available
GENOMIC FEATURES CREATED WITH TALEN1-zc4h2
Genomic Feature Affected Genomic Regions    
ck035a zc4h2    
ck035b zc4h2    
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-zc4h2 No data available
PHENOTYPE
Phenotype resulting from TALEN1-zc4h2
No data available

Phenotype of all Fish created by or utilizing TALEN1-zc4h2
OTHER TALEN1-zc4h2 TALEN PAGESNo links to external sites
CITATIONS (2)