header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-181004-1
Morpholino Name: MO1-pdk1
Target: pdk1 (1)
Sequence:
5' - AAGTCCTGAAGATCCTCATGTTGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pdk1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pdk1 No data available
PHENOTYPE
Phenotype resulting from MO1-pdk1
No data available

Phenotype of all Fish created by or utilizing MO1-pdk1
OTHER MO1-pdk1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)