ZFIN ID: ZDB-MRPHLNO-180830-11
Morpholino Name: MO4-zic2b
Target: zic2b (1)
Sequence:
5' - CACGATTATTGACCAAAGAATGCGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-zic2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-zic2b No data available
PHENOTYPE
Phenotype resulting from MO4-zic2b
No data available

Phenotype of all Fish created by or utilizing MO4-zic2b
Genome Resources:
CITATIONS (1)