ZFIN ID: ZDB-MRPHLNO-180824-2
Morpholino Name: MO1-rac3b
Target: rac3b (1)
Previous Name: MO-Rac3bSBI4E5 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TACCACTGCAGCACAGAACATCACT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rac3b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rac3b No data available
PHENOTYPE
Phenotype resulting from MO1-rac3b
Phenotype of all Fish created by or utilizing MO1-rac3b
Genome Resources:
CITATIONS (2)