ZFIN ID: ZDB-MRPHLNO-180723-4
Morpholino Name: MO1-adtrp1
Target: adtrp1 (1)
Sequence:
5' - CCAGTCTCGTGGAGGCAGCCATCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: targets the translation initiation codon
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-adtrp1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-adtrp1
Expressed Gene Anatomy Figures
etsrp Fig. 1 from Wang et al., 2017
fli1 Fig. 1 from Wang et al., 2017
gata1a Fig. 2 from Wang et al., 2017
hbae1.1 Fig. 2 from Wang et al., 2017
lcp1 Fig. 2Fig. 3 from Wang et al., 2017
mpx Fig. 2Fig. 3Fig. 6 from Wang et al., 2017
myb Fig. 3 from Wang et al., 2017
rag1 Fig. 3 from Wang et al., 2017
runx1 Fig. 3Fig. 6Fig. 7 from Wang et al., 2017
spi1b Fig. 2 from Wang et al., 2017
tal1 Fig. 6Fig. 7 from Wang et al., 2017
tfpia Fig. 6 from Wang et al., 2017
PHENOTYPE
Phenotype resulting from MO1-adtrp1
Phenotype Figures
angioblastic mesenchymal cell tal1 expression decreased amount, abnormal Fig. 6Fig. 7 from Wang et al., 2017
anterior lateral mesoderm hematopoietic cell etsrp expression decreased amount, abnormal Fig. 1 from Wang et al., 2017
anterior lateral mesoderm hematopoietic cell fli1 expression decreased amount, abnormal Fig. 1 from Wang et al., 2017
apoptotic process increased occurrence, abnormal Fig. 3 from Wang et al., 2017
granulocyte monocyte progenitor cell lcp1 expression decreased amount, abnormal Fig. 2Fig. 3 from Wang et al., 2017
granulocyte monocyte progenitor cell mpx expression decreased amount, abnormal Fig. 2Fig. 3Fig. 6 from Wang et al., 2017
hematopoietic stem cell myb expression decreased amount, abnormal Fig. 3 from Wang et al., 2017
hematopoietic stem cell GFP expression decreased amount, abnormal Fig. 3 from Wang et al., 2017
hematopoietic stem cell runx1 expression decreased amount, abnormal Fig. 3Fig. 6Fig. 7 from Wang et al., 2017
lymphocyte rag1 expression absent, abnormal Fig. 3 from Wang et al., 2017
myeloid lineage restricted progenitor cell spi1b expression decreased amount, abnormal Fig. 2 from Wang et al., 2017
nucleate erythrocyte hemoglobin complex decreased amount, abnormal Fig. 3 from Wang et al., 2017
posterior lateral mesoderm hematopoietic cell fli1 expression decreased amount, abnormal Fig. 1 from Wang et al., 2017
posterior lateral mesoderm hematopoietic cell etsrp expression decreased amount, abnormal Fig. 1 from Wang et al., 2017
whole organism tfpia expression decreased amount, abnormal Fig. 6 from Wang et al., 2017

Phenotype of all Fish created by or utilizing MO1-adtrp1
Phenotype Fish Conditions Figures
posterior lateral mesoderm hematopoietic cell etsrp expression decreased amount, abnormal WT + MO1-adtrp1 standard conditions Fig. 1 from Wang et al., 2017
lymphocyte rag1 expression absent, abnormal WT + MO1-adtrp1 standard conditions Fig. 3 from Wang et al., 2017
granulocyte monocyte progenitor cell mpx expression decreased amount, abnormal WT + MO1-adtrp1 standard conditions Fig. 2Fig. 3Fig. 6 from Wang et al., 2017
anterior lateral mesoderm hematopoietic cell fli1 expression decreased amount, abnormal WT + MO1-adtrp1 standard conditions Fig. 1 from Wang et al., 2017
hematopoietic stem cell myb expression decreased amount, abnormal WT + MO1-adtrp1 standard conditions Fig. 3 from Wang et al., 2017
posterior lateral mesoderm hematopoietic cell fli1 expression decreased amount, abnormal WT + MO1-adtrp1 standard conditions Fig. 1 from Wang et al., 2017
anterior lateral mesoderm hematopoietic cell etsrp expression decreased amount, abnormal WT + MO1-adtrp1 standard conditions Fig. 1 from Wang et al., 2017
granulocyte monocyte progenitor cell lcp1 expression decreased amount, abnormal WT + MO1-adtrp1 standard conditions Fig. 2Fig. 3 from Wang et al., 2017
myeloid lineage restricted progenitor cell spi1b expression decreased amount, abnormal WT + MO1-adtrp1 standard conditions Fig. 2 from Wang et al., 2017
whole organism tfpia expression decreased amount, abnormal WT + MO1-adtrp1 standard conditions Fig. 6 from Wang et al., 2017
angioblastic mesenchymal cell tal1 expression decreased amount, abnormal WT + MO1-adtrp1 standard conditions Fig. 6Fig. 7 from Wang et al., 2017
hematopoietic stem cell runx1 expression decreased amount, abnormal WT + MO1-adtrp1 standard conditions Fig. 3Fig. 6Fig. 7 from Wang et al., 2017
nucleate erythrocyte hemoglobin complex decreased amount, abnormal WT + MO1-adtrp1 standard conditions Fig. 3 from Wang et al., 2017
hematopoietic stem cell GFP expression decreased amount, abnormal zf289Tg ; is5Tg + MO1-adtrp1 standard conditions Fig. 3 from Wang et al., 2017
apoptotic process increased occurrence, abnormal zf289Tg ; is5Tg + MO1-adtrp1 standard conditions Fig. 3 from Wang et al., 2017
angioblastic mesenchymal cell tal1 expression decreased amount, abnormal WT + MO1-adtrp1 + MO1-adtrp2 standard conditions Fig. 5 from Wang et al., 2017
hematopoietic stem cell runx1 expression decreased amount, abnormal WT + MO1-adtrp1 + MO1-adtrp2 standard conditions Fig. 5 from Wang et al., 2017
Genome Resources:
CITATIONS (1)