header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-180516-2
Morpholino Name: MO7-smc3
Target: smc3 (1)
Sequence:
5' - GCGTGAGTCGCATCTTACCTGTTTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO7-smc3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO7-smc3 No data available
PHENOTYPE
Phenotype resulting from MO7-smc3
No data available

Phenotype of all Fish created by or utilizing MO7-smc3
Phenotype Fish Conditions Figures
regenerating fin hapln1a expression decreased amount, abnormal C32 + MO7-smc3 amputation: caudal fin Fig. 4 with image from Banerji et al., 2017
regenerating fin cell population proliferation decreased occurrence, abnormal C32 + MO7-smc3 amputation: caudal fin Fig. 3 with image from Banerji et al., 2017
regenerating fin decreased length, abnormal C32 + MO7-smc3 amputation: caudal fin Fig. 3 with image from Banerji et al., 2017
regenerating fin cx43 expression decreased amount, abnormal C32 + MO7-smc3 amputation: caudal fin Fig. 4 with image from Banerji et al., 2017
regenerating fin sema3d expression decreased amount, abnormal C32 + MO7-smc3 amputation: caudal fin Fig. 4 with image from Banerji et al., 2017
fin regeneration decreased efficacy, abnormal C32 + MO7-smc3 amputation: caudal fin Fig. 3 with image from Banerji et al., 2017
regenerating fin caudal fin lepidotrichium decreased length, abnormal C32 + MO7-smc3 amputation: caudal fin Fig. 3 with image from Banerji et al., 2017
caudal fin lepidotrichium fin regeneration decreased efficacy, abnormal C32 + MO7-smc3 amputation: caudal fin Fig. 3 with image from Banerji et al., 2017
regenerating fin length, ameliorated pd48Tg + MO7-smc3 heat shock, amputation: caudal fin Fig. 5 from Banerji et al., 2017
caudal fin lepidotrichium fin regeneration process efficacy, ameliorated pd48Tg + MO7-smc3 heat shock, amputation: caudal fin Fig. 5 from Banerji et al., 2017
regenerating fin decreased length, abnormal pd48Tg + MO7-smc3 amputation: caudal fin Fig. 5 from Banerji et al., 2017
regenerating fin caudal fin lepidotrichium length, ameliorated pd48Tg + MO7-smc3 heat shock, amputation: caudal fin Fig. 5 from Banerji et al., 2017
fin regeneration process efficacy, ameliorated pd48Tg + MO7-smc3 heat shock, amputation: caudal fin Fig. 5 from Banerji et al., 2017
fin regeneration decreased efficacy, abnormal pd48Tg + MO7-smc3 amputation: caudal fin Fig. 5 from Banerji et al., 2017
caudal fin lepidotrichium fin regeneration decreased efficacy, abnormal pd48Tg + MO7-smc3 amputation: caudal fin Fig. 5 from Banerji et al., 2017
regenerating fin caudal fin lepidotrichium decreased length, abnormal pd48Tg + MO7-smc3 amputation: caudal fin Fig. 5 from Banerji et al., 2017
regenerating fin decreased length, exacerbated cx43b123/+ + MO7-smc3 amputation: caudal fin Fig. 6 from Banerji et al., 2017
regenerating fin caudal fin lepidotrichium decreased length, exacerbated cx43b123/+ + MO7-smc3 amputation: caudal fin Fig. 6 from Banerji et al., 2017
Genome Resources:
CITATIONS (1)