ZFIN ID: ZDB-MRPHLNO-180508-1
Morpholino Name: MO7-jag1b
Target: jag1b (1)
Sequence:
5' - TCACGGCTCTAATGTACTCCCCGAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO7-jag1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO7-jag1b No data available
PHENOTYPE
Phenotype resulting from MO7-jag1b
No data available

Phenotype of all Fish created by or utilizing MO7-jag1b
No data available
Genome Resources:
CITATIONS (1)