ZFIN ID: ZDB-MRPHLNO-180118-2
Morpholino Name: MO1-myca
Target: myca (1)
Sequence:
5' - CATTTTGACACTTGAGGAAGGAGAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-myca No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-myca
Expressed Gene Anatomy Figures
vegfaa Fig. 5 from Shi et al., 2014
PHENOTYPE
Phenotype resulting from MO1-myca
Phenotype Figures
intersegmental vessel decreased branchiness, abnormal Fig. 5 from Shi et al., 2014
whole organism vegfaa expression decreased amount, abnormal Fig. 5 from Shi et al., 2014

Phenotype of all Fish created by or utilizing MO1-myca
Phenotype Fish Conditions Figures
whole organism vegfaa expression decreased amount, abnormal y1Tg + MO1-myca standard conditions Fig. 5 from Shi et al., 2014
intersegmental vessel decreased branchiness, abnormal y1Tg + MO1-myca standard conditions Fig. 5 from Shi et al., 2014
intersegmental vessel branchiness, ameliorated y1Tg + MO1-myca + MO1-sars standard conditions Fig. 5 from Shi et al., 2014
whole organism vegfaa expression amount, ameliorated y1Tg + MO1-myca + MO1-sars standard conditions Fig. 5 from Shi et al., 2014
OTHER MO1-myca MORPHOLINO PAGESNo links to external sites
CITATIONS (2)