ZFIN ID: ZDB-MRPHLNO-171109-5
Morpholino Name: MO2-mavs
Target: mavs (1)
Sequence:
5' - GCAAAACGACCCATATACGGCCTAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-mavs No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-mavs No data available
PHENOTYPE
Phenotype resulting from MO2-mavs
No data available

Phenotype of all Fish created by or utilizing MO2-mavs
Genome Resources:
CITATIONS (1)