ZFIN ID: ZDB-MRPHLNO-170801-2
Morpholino Name: MO1-pou4f1
Target: pou4f1 (1)
Sequence:
5' - AGCGTCTCATCCAGACTGGCGAAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pou4f1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pou4f1 No data available
PHENOTYPE
Phenotype resulting from MO1-pou4f1
No data available

Phenotype of all Fish created by or utilizing MO1-pou4f1
Phenotype Fish Conditions Figures
heart linear, abnormal WT + MO1-pou4f1 + MO1-pou4f2 standard conditions Fig. 5 with image from Maskell et al., 2017
heart development disrupted, abnormal WT + MO1-pou4f1 + MO1-pou4f2 standard conditions Fig. 5 with imageFig. S1 with image from Maskell et al., 2017
heart contraction disrupted, abnormal WT + MO1-pou4f1 + MO1-pou4f2 standard conditions Fig. S1 with image from Maskell et al., 2017
whole organism Ab1-pou4f2 labeling decreased amount, abnormal WT + MO1-pou4f1 + MO1-pou4f2 standard conditions Fig. 5 with image from Maskell et al., 2017
heart looping disrupted, abnormal WT + MO1-pou4f1 + MO1-pou4f2 standard conditions Fig. 5 with image from Maskell et al., 2017
whole organism Ab1-pou4f1 labeling decreased amount, abnormal WT + MO1-pou4f1 + MO1-pou4f2 standard conditions Fig. 5 with image from Maskell et al., 2017
heart linear, abnormal mss5Tg + MO1-pou4f1 + MO1-pou4f2 standard conditions Fig. 5 with image from Maskell et al., 2017
sinus venosus decreased thickness, abnormal mss5Tg + MO1-pou4f1 + MO1-pou4f2 standard conditions Fig. 5 with image from Maskell et al., 2017
heart development disrupted, abnormal mss5Tg + MO1-pou4f1 + MO1-pou4f2 standard conditions Fig. 5 with image from Maskell et al., 2017
heart looping disrupted, abnormal mss5Tg + MO1-pou4f1 + MO1-pou4f2 standard conditions Fig. 5 with image from Maskell et al., 2017
OTHER MO1-pou4f1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)