header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-170330-5
Morpholino Name: MO3-nfe2
Target: nfe2 (1)
Sequence:
5' - GTTCCTGCCAGGCCAAGTCCATCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-nfe2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-nfe2 No data available
PHENOTYPE
Phenotype resulting from MO3-nfe2
No data available

Phenotype of all Fish created by or utilizing MO3-nfe2
No data available
OTHER MO3-nfe2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)