Community Action Needed: Please respond to the NIH RFI
Morpholino

MO4-foxo1a

ID
ZDB-MRPHLNO-170327-6
Name
MO4-foxo1a
Previous Names
  • foxo1a_TP_1 (1)
Target
Sequence
5' - TTACAGCGATTCCCGCTCTTCCAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Target protector MO, targets the 3"UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-foxo1a
No data available
Phenotype
Phenotype resulting from MO4-foxo1a
No data available
Phenotype of all Fish created by or utilizing MO4-foxo1a
Citations