Community Action Needed: Please respond to the NIH RFI
Morpholino

MO2-zeb1a

ID
ZDB-MRPHLNO-170327-1
Name
MO2-zeb1a
Previous Names
None
Target
Sequence
5' - GGCCATCCGCCATGATTTTTTGCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-zeb1a
Expressed Gene Anatomy Figures
cdh1 Fig. 4 with image from Gays et al., 2017
oclna Fig. 4 with image from Gays et al., 2017
Phenotype
Phenotype resulting from MO2-zeb1a
Phenotype of all Fish created by or utilizing MO2-zeb1a
Citations