ZFIN ID: ZDB-MRPHLNO-160621-57
Morpholino Name: MO3-srebf1
Target: srebf1 (1)
Previous Name: exon 6 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCGCCTGACAACACGACACACGGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-srebf1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-srebf1 No data available
PHENOTYPE
Phenotype resulting from MO3-srebf1
Phenotype of all Fish created by or utilizing MO3-srebf1
Genome Resources:
CITATIONS (1)