ZFIN ID: ZDB-MRPHLNO-160526-5
Morpholino Name: MO1-ctsbb
Target: ctsbb (1)
Sequence:
5' - ACACTGCAGATGGAGAAAACAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ctsbb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ctsbb No data available
PHENOTYPE
Phenotype resulting from MO1-ctsbb
No data available

Phenotype of all Fish created by or utilizing MO1-ctsbb
No data available
Genome Resources:
CITATIONS (1)