ZFIN ID: ZDB-MRPHLNO-160421-1
Morpholino Name: MO3-hif1al
Target: hif1al (1)
Sequence:
5' - ACTTCTCCACTCCTTCCATCTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-hif1al No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-hif1al
Expressed Gene Anatomy Figures
dharma Fig. 8 with image from Zhang et al., 2016
tp63 Fig. 8 with image from Zhang et al., 2016
vent Fig. 7 with imageFig. 8 with image from Zhang et al., 2016
vox Fig. 7 with imageFig. 8 with image from Zhang et al., 2016
PHENOTYPE
Phenotype resulting from MO3-hif1al
Phenotype of all Fish created by or utilizing MO3-hif1al
Genome Resources:
CITATIONS (1)