ZFIN ID: ZDB-MRPHLNO-160411-3
Morpholino Name: MO1-srebf1
Target: srebf1 (1)
Sequence:
5' - AAGTGTCGTCAAAAGACAGATTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-srebf1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-srebf1
Expressed Gene Anatomy Figures
fabp10a Fig. S7 from Liu et al., 2016
PHENOTYPE
Phenotype resulting from MO1-srebf1
Phenotype of all Fish created by or utilizing MO1-srebf1
Genome Resources:
CITATIONS (1)