ZFIN ID: ZDB-MRPHLNO-160310-7
Morpholino Name: MO3-bves
Target: bves (1)
Previous Name: splice-acceptor site of exon 4 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTTAATCTGGAATTAAACAGGAGAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-bves No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-bves No data available
PHENOTYPE
Phenotype resulting from MO3-bves
No data available

Phenotype of all Fish created by or utilizing MO3-bves
Phenotype Fish Conditions Figures
slow muscle cell myofibril morphology, abnormal AB + MO3-bves + MO4-bves standard conditions Fig. S15 from Schindler et al., 2016
atrioventricular node decreased functionality, abnormal AB + MO3-bves + MO4-bves standard conditions Fig. S15 from Schindler et al., 2016
skeletal muscle cell muscle tendon junction morphology, abnormal AB + MO3-bves + MO4-bves standard conditions Fig. S15 from Schindler et al., 2016
heart edematous, abnormal AB + MO3-bves + MO4-bves standard conditions Fig. S15 from Schindler et al., 2016
OTHER MO3-bves MORPHOLINO PAGESNo links to external sites
CITATIONS (1)